ID: 1178179220

View in Genome Browser
Species Human (GRCh38)
Location 21:30140652-30140674
Sequence CAATTTCTCCCTTCCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178179220_1178179224 14 Left 1178179220 21:30140652-30140674 CCTTGGGAGGAAGGGAGAAATTG No data
Right 1178179224 21:30140689-30140711 CTGGATATGCATATCAGACAAGG No data
1178179220_1178179226 21 Left 1178179220 21:30140652-30140674 CCTTGGGAGGAAGGGAGAAATTG No data
Right 1178179226 21:30140696-30140718 TGCATATCAGACAAGGGTAAAGG No data
1178179220_1178179223 -5 Left 1178179220 21:30140652-30140674 CCTTGGGAGGAAGGGAGAAATTG No data
Right 1178179223 21:30140670-30140692 AATTGGAAATTGTAGGCTTCTGG No data
1178179220_1178179225 15 Left 1178179220 21:30140652-30140674 CCTTGGGAGGAAGGGAGAAATTG No data
Right 1178179225 21:30140690-30140712 TGGATATGCATATCAGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178179220 Original CRISPR CAATTTCTCCCTTCCTCCCA AGG (reversed) Intergenic
No off target data available for this crispr