ID: 1178179224

View in Genome Browser
Species Human (GRCh38)
Location 21:30140689-30140711
Sequence CTGGATATGCATATCAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178179220_1178179224 14 Left 1178179220 21:30140652-30140674 CCTTGGGAGGAAGGGAGAAATTG No data
Right 1178179224 21:30140689-30140711 CTGGATATGCATATCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178179224 Original CRISPR CTGGATATGCATATCAGACA AGG Intergenic
No off target data available for this crispr