ID: 1178180754

View in Genome Browser
Species Human (GRCh38)
Location 21:30158491-30158513
Sequence CTTTCCAGGGATACACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178180754_1178180758 3 Left 1178180754 21:30158491-30158513 CCTTGCTGTGTATCCCTGGAAAG No data
Right 1178180758 21:30158517-30158539 ATATAACCTCTTTGAGCATCAGG No data
1178180754_1178180761 28 Left 1178180754 21:30158491-30158513 CCTTGCTGTGTATCCCTGGAAAG No data
Right 1178180761 21:30158542-30158564 TTTCTTAACACATAAAAGAAGGG No data
1178180754_1178180760 27 Left 1178180754 21:30158491-30158513 CCTTGCTGTGTATCCCTGGAAAG No data
Right 1178180760 21:30158541-30158563 TTTTCTTAACACATAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178180754 Original CRISPR CTTTCCAGGGATACACAGCA AGG (reversed) Intergenic
No off target data available for this crispr