ID: 1178181025

View in Genome Browser
Species Human (GRCh38)
Location 21:30161764-30161786
Sequence ATGCAACTGTGTTTGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178181025_1178181030 19 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181030 21:30161806-30161828 AGATCTTTAACATATAAATGGGG No data
1178181025_1178181033 25 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181033 21:30161812-30161834 TTAACATATAAATGGGGGGAAGG No data
1178181025_1178181027 -6 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181027 21:30161781-30161803 TTGCATTTTCATTTATGCAGAGG No data
1178181025_1178181029 18 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181029 21:30161805-30161827 GAGATCTTTAACATATAAATGGG No data
1178181025_1178181028 17 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181028 21:30161804-30161826 TGAGATCTTTAACATATAAATGG No data
1178181025_1178181032 21 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181032 21:30161808-30161830 ATCTTTAACATATAAATGGGGGG No data
1178181025_1178181031 20 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181031 21:30161807-30161829 GATCTTTAACATATAAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178181025 Original CRISPR ATGCAACTGTGTTTGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr