ID: 1178181032

View in Genome Browser
Species Human (GRCh38)
Location 21:30161808-30161830
Sequence ATCTTTAACATATAAATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178181025_1178181032 21 Left 1178181025 21:30161764-30161786 CCTATCTCCAAACACAGTTGCAT No data
Right 1178181032 21:30161808-30161830 ATCTTTAACATATAAATGGGGGG No data
1178181024_1178181032 22 Left 1178181024 21:30161763-30161785 CCCTATCTCCAAACACAGTTGCA No data
Right 1178181032 21:30161808-30161830 ATCTTTAACATATAAATGGGGGG No data
1178181026_1178181032 14 Left 1178181026 21:30161771-30161793 CCAAACACAGTTGCATTTTCATT No data
Right 1178181032 21:30161808-30161830 ATCTTTAACATATAAATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178181032 Original CRISPR ATCTTTAACATATAAATGGG GGG Intergenic
No off target data available for this crispr