ID: 1178189421

View in Genome Browser
Species Human (GRCh38)
Location 21:30263465-30263487
Sequence GCATCTCTGCAGATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 2, 2: 5, 3: 23, 4: 319}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178189409_1178189421 30 Left 1178189409 21:30263412-30263434 CCTAGACTATCCCGTCTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG 0: 1
1: 2
2: 5
3: 23
4: 319
1178189415_1178189421 -4 Left 1178189415 21:30263446-30263468 CCCACTTTGGCCAGCAGAGGCAT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG 0: 1
1: 2
2: 5
3: 23
4: 319
1178189411_1178189421 20 Left 1178189411 21:30263422-30263444 CCCGTCTGGCGGGCAGCAATGAG No data
Right 1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG 0: 1
1: 2
2: 5
3: 23
4: 319
1178189416_1178189421 -5 Left 1178189416 21:30263447-30263469 CCACTTTGGCCAGCAGAGGCATC 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG 0: 1
1: 2
2: 5
3: 23
4: 319
1178189412_1178189421 19 Left 1178189412 21:30263423-30263445 CCGTCTGGCGGGCAGCAATGAGA 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG 0: 1
1: 2
2: 5
3: 23
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178189421 Original CRISPR GCATCTCTGCAGATGGTGGA GGG Intergenic
900240093 1:1612469-1612491 GAATCTGTTCAGTTGGTGGAGGG + Intergenic
900287431 1:1908441-1908463 CCATCACTGCAGAGGGTGGCAGG + Intergenic
900986483 1:6076134-6076156 GCAGCCCTGCAGATAGTGCAGGG - Intronic
902096261 1:13948417-13948439 GCATCTCTTCATAGGGTGGCAGG - Intergenic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
904819539 1:33232587-33232609 TCATGTCTGCGGATGGTGGCTGG + Intergenic
906663046 1:47596050-47596072 GCATGTCTTCAGATGGTGGCAGG + Intergenic
907138758 1:52164668-52164690 GCATGTCTGCAAAGGATGGATGG - Intronic
907987693 1:59548348-59548370 GCAATTCTGCAGGTCGTGGATGG + Intronic
909188755 1:72524256-72524278 TCAGCTTTGAAGATGGTGGAAGG + Intergenic
910508300 1:87975740-87975762 TTATCTCTGAAGATGGAGGAAGG - Intergenic
912498923 1:110108960-110108982 GCCTCTCTGCAGAGGGAGCAGGG - Intergenic
913386421 1:118262820-118262842 GATTCTCTGCAGATAGTGGCTGG - Intergenic
913570588 1:120115977-120115999 GCATCTCTCCAAAGGGTGGAAGG + Intergenic
914719325 1:150276456-150276478 GAATCTATGAAGATGTTGGATGG + Intronic
915281640 1:154826603-154826625 GCCTCGCTGCAGATATTGGAGGG - Intronic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
918076614 1:181175642-181175664 GGAGCTCTGCAGCTGCTGGAGGG - Intergenic
919267452 1:195288994-195289016 TTATCTCTGAAGATGGAGGAAGG + Intergenic
920079020 1:203358691-203358713 GAATCTCTGCAGACGGTGCCTGG + Intergenic
920809414 1:209268136-209268158 ACACCACTGCAGATAGTGGATGG + Intergenic
921704515 1:218306519-218306541 GCATCCCTGCATATGGTTGCTGG - Intronic
921882864 1:220274037-220274059 GCATTTCTTCAGATGGAAGAAGG - Intergenic
922136542 1:222833023-222833045 CCATCTCTTCAGCTGGAGGAGGG + Intergenic
922138273 1:222854346-222854368 GCATCTCTTCAAAGGGTGGCAGG + Intergenic
923540837 1:234886967-234886989 GCATTTCTGCAGAGGGGCGAGGG - Intergenic
1063164307 10:3446074-3446096 GGATCTCTGCAGACAGGGGAAGG - Intergenic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1063521699 10:6747369-6747391 GCAGCTCAGCAGATGGTGGAAGG - Intergenic
1063700796 10:8383495-8383517 GAATCTCAGCAGATGAAGGAAGG - Intergenic
1064317340 10:14270495-14270517 GGCTCTCTGCAGAGGGTGGGAGG - Intronic
1064872055 10:19948505-19948527 ACATCTCTATTGATGGTGGATGG + Intronic
1065765265 10:29023802-29023824 GCATCTCTGCCGATCTTGGCTGG - Intergenic
1065934157 10:30505732-30505754 TCATCTCTGCATATGGTGTTGGG + Intergenic
1067131631 10:43570513-43570535 GCATCTCTGAAGATAGAAGAAGG - Intronic
1070767755 10:79066553-79066575 GCATCCCTGGAGAGGGTGGGTGG - Intergenic
1071906484 10:90179999-90180021 GCATCCATGCAGACTGTGGAAGG - Intergenic
1073295086 10:102433932-102433954 TCATCCCTGCTGATGGGGGATGG - Intergenic
1075082064 10:119390963-119390985 GCATCTCTCCACGTGGTGGAGGG - Intronic
1076213630 10:128674170-128674192 GAATTTCTGCAGATGGAGGGTGG + Intergenic
1077528793 11:3085517-3085539 GCAACTTTGCAGGAGGTGGAAGG - Intergenic
1077719996 11:4618448-4618470 ACATCTTTGCAGATTGGGGAAGG - Intergenic
1077906540 11:6538996-6539018 TCCTCTCTGCTGATGGTGGCTGG + Intronic
1078205801 11:9228353-9228375 TCCTCTCTGCAGGTGGTGGTGGG - Intronic
1078527638 11:12112236-12112258 GCATCTTTTCAGAGGCTGGAAGG - Intronic
1078936641 11:15957136-15957158 GCATGTCTTCACATGGTGGCAGG + Intergenic
1079319881 11:19442908-19442930 ACATTTCTCCCGATGGTGGAAGG - Intronic
1080300890 11:30783936-30783958 GCATCTCTACAGTTGGCTGAGGG + Intergenic
1081073826 11:38643173-38643195 GAATCTGTGCACTTGGTGGAAGG - Intergenic
1081076076 11:38675476-38675498 GCATCTCTTCACAGGGTGGCAGG - Intergenic
1081575097 11:44314222-44314244 CCAGCTCTGCAAATGGTGGAAGG + Intergenic
1081857972 11:46315997-46316019 GCATCTGTGCAGCTGGGGGCAGG + Intronic
1083199310 11:61110316-61110338 GGATTTCAGCAGCTGGTGGAGGG - Intronic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1084314352 11:68336032-68336054 GCCTCTCTGCTGATGGAGGTAGG - Intronic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1084437968 11:69155166-69155188 ACATCACTGCTGATGGTGGGGGG + Intergenic
1085188258 11:74594775-74594797 GCATCTCTTCACAGGGTGGCAGG + Intronic
1085313672 11:75530858-75530880 GCCTCTGTGCTGAGGGTGGAGGG + Intergenic
1085893137 11:80604898-80604920 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1086143428 11:83524316-83524338 GAATCTCTGGAGATGGGGGCAGG - Intronic
1087902934 11:103663071-103663093 ACATCTCTGCAGTTGGCCGAGGG - Intergenic
1088762924 11:112949336-112949358 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1090179508 11:124684108-124684130 GCATCTCTTCACAGGGTGGCAGG - Intronic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1092019510 12:5189200-5189222 GCATCTTTGCAGAGTGGGGATGG + Intergenic
1092785762 12:12025223-12025245 GCAACGCTACAGATGGTGCAGGG + Intergenic
1093985579 12:25528728-25528750 GCTTCACTGCAGATGGAAGAAGG - Intronic
1096737858 12:53669900-53669922 GCACCACTGCAGATAGCGGACGG + Exonic
1097237678 12:57550840-57550862 GGGTCTCTGCAGAGTGTGGATGG + Intronic
1097343787 12:58468591-58468613 GCATGTCTTCACATGTTGGAAGG + Intergenic
1099237284 12:80096520-80096542 ACATCTCTGCCAATGGTAGAGGG + Intergenic
1100686762 12:96995029-96995051 ATATCTCTGCAGAGGGAGGAGGG - Intergenic
1101382408 12:104225625-104225647 GCACCTCTTCACATGGTGGCAGG - Intronic
1102134721 12:110564087-110564109 TCAACTCTGCAGTTTGTGGAAGG - Intronic
1102588551 12:113940346-113940368 GCAGCTCTGCAGAGGGGGTAAGG + Intronic
1103192426 12:119013038-119013060 GCATATCTGGAGATGCTGGAGGG - Intronic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1103928067 12:124434577-124434599 GGATCGCTGCAGCTGCTGGAAGG - Intronic
1104365086 12:128169554-128169576 GTATCTCTGCAGATGGATGAGGG - Intergenic
1106332830 13:28755015-28755037 GCATCACTGCAGAAGATGGCCGG - Intergenic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106469848 13:30044651-30044673 GCATCTCTGCAAATTGAGGGAGG - Intergenic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1109956279 13:69571086-69571108 ACTTCTCTGAGGATGGTGGAGGG + Intergenic
1110146156 13:72192862-72192884 GAACCTATGAAGATGGTGGAGGG + Intergenic
1110315965 13:74107083-74107105 GCTTGTCTTCACATGGTGGAAGG + Intronic
1112493709 13:99888974-99888996 GCATCACTGCAAATGGAGGATGG - Intronic
1112840154 13:103565434-103565456 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113232342 13:108226718-108226740 ACATCTCAGCAGATGGTGCATGG + Intronic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1114647674 14:24264536-24264558 GCATCACTGCAGATACGGGAAGG + Intergenic
1115099844 14:29685363-29685385 GCTTCCCTGCAGATGATGAAAGG - Intronic
1115816798 14:37172292-37172314 GCTTCTCGGCAGATCGTGGCCGG - Exonic
1115959871 14:38823528-38823550 GCATCTCTTCATAGGGTGGCAGG - Intergenic
1116794365 14:49374029-49374051 GCACCACTGCAGATAGTGGATGG - Intergenic
1117249497 14:53922318-53922340 GCATCTATGCCTATGGTGCATGG + Intergenic
1117252674 14:53952394-53952416 GCATGGCTGCAGCTGGTGGGTGG - Intronic
1117798457 14:59418842-59418864 GCATCTCTGAAGCAAGTGGATGG + Intergenic
1120200259 14:81531365-81531387 GCATCTCTCCAGGTGGAGTATGG - Intronic
1120318047 14:82921378-82921400 GCATATCTTCACATGGTGGCAGG - Intergenic
1120708440 14:87769089-87769111 GCATCTCTTCACAAGGTGGCAGG + Intergenic
1121685913 14:95834939-95834961 GCTTCTCTGCACCTGCTGGAGGG + Intergenic
1122114562 14:99521303-99521325 GCATTCCTGGAGAAGGTGGAAGG + Intronic
1122801906 14:104235221-104235243 GCACCTCTTCACAGGGTGGAAGG - Intergenic
1122873393 14:104651553-104651575 GCATCCCACCACATGGTGGAGGG + Intergenic
1123428219 15:20190599-20190621 GCATATCTTCACATGGTGGCAGG - Intergenic
1123968967 15:25486714-25486736 GAATCCCTGCAGATCTTGGACGG + Intergenic
1124090100 15:26591123-26591145 GCATCTCTGCTGATTCTGGCTGG - Intronic
1125546166 15:40507231-40507253 GCGTCTCTGCAGATCCTGCAGGG - Intergenic
1127715234 15:61643251-61643273 GCATCTTAGAAGATCGTGGATGG + Intergenic
1128241339 15:66103210-66103232 GCATCTCTGGAGGTTGAGGAGGG - Intronic
1128336125 15:66786832-66786854 TCATCCCTGCAGGTGGAGGATGG - Intergenic
1128646697 15:69383574-69383596 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646725 15:69383695-69383717 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646732 15:69383725-69383747 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646739 15:69383755-69383777 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646802 15:69384026-69384048 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646809 15:69384056-69384078 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646817 15:69384087-69384109 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646824 15:69384117-69384139 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646831 15:69384147-69384169 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1129198735 15:73986105-73986127 GCAGCTCTGGCGAGGGTGGAGGG + Intronic
1129956657 15:79643288-79643310 TCATATCTCCACATGGTGGAAGG - Intergenic
1130137994 15:81197603-81197625 GCATCTCTGCAGATTGACCATGG + Intronic
1131764538 15:95661109-95661131 GCATCTCTGCTGCTTTTGGATGG + Intergenic
1133229134 16:4358230-4358252 GCATCTCAGCAGAAGGGGGTAGG + Intronic
1133452029 16:5911769-5911791 CCATGTCTGCATATGGTGGGAGG + Intergenic
1134374058 16:13653405-13653427 GAATCTAGGCAGATGGAGGAAGG + Intergenic
1136856099 16:33659151-33659173 GCATATCTTCACATGGTGGCAGG + Intergenic
1140306257 16:73806044-73806066 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1140621217 16:76735491-76735513 GCATCTCAGAAGATGCTGGCAGG + Intergenic
1140695157 16:77525368-77525390 GCATGGCTGCAGCTGGTGGAGGG + Intergenic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1203117685 16_KI270728v1_random:1507630-1507652 GCATATCTTCACATGGTGGCAGG + Intergenic
1142482054 17:225163-225185 GCCTCTGAGCAGATGGAGGAAGG - Intronic
1144215609 17:13052492-13052514 GCTTGTCTTCACATGGTGGAAGG - Intergenic
1144909346 17:18668108-18668130 GCCTCTCTGCAGGTGGCTGAGGG + Intronic
1145984479 17:29036025-29036047 GCATCTCTGCAGAGAAGGGAGGG + Intronic
1148638352 17:49166279-49166301 CCATCTCTACAGATTGTGGCTGG - Intronic
1148763410 17:50021428-50021450 GCACATCTGCAGATTGTGCAAGG - Intergenic
1149419812 17:56499055-56499077 GCATCTCTGGGGATGGGGGTGGG - Intronic
1149561303 17:57609674-57609696 GCATCTTTGGGGATGGTGGCTGG - Intronic
1151214163 17:72566194-72566216 GCATCGCTGGGGATGGAGGATGG + Intergenic
1151823918 17:76512975-76512997 GCATCTCTGAGGGTGATGGAGGG + Intergenic
1152296069 17:79467613-79467635 GCCTAACTGCAGATGGTGGGGGG + Intronic
1153560303 18:6365708-6365730 GCATTTTTGCAGAAGATGGAAGG - Intronic
1154074588 18:11187791-11187813 CCAGCTCGGCAGATGGAGGAGGG + Intergenic
1155575761 18:27244929-27244951 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1155638878 18:27988762-27988784 GCATTTCTGTAGATGATGGCTGG + Intronic
1156670101 18:39458640-39458662 GCATGTCTTCACATGGTGGCAGG - Intergenic
1157110949 18:44819983-44820005 TCATCATTGCTGATGGTGGAAGG + Intronic
1157722638 18:49937174-49937196 GCCTCTCTGTAGATGAAGGATGG - Intronic
1159100723 18:63955585-63955607 GCAGTTCTGCTGATGGTGGGTGG - Intronic
1160133401 18:76249806-76249828 GCATGCCTGCAGGTAGTGGAGGG + Intergenic
1160261149 18:77295358-77295380 GCATCTCAGAAGATGGAGAATGG + Intergenic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1166352644 19:42207341-42207363 AAAGCTCTGCAGATGGTAGAAGG + Intronic
1167583346 19:50359295-50359317 GCGACTCTGCGGATGGTGGCCGG - Intronic
1167632281 19:50632524-50632546 GCAGCTCAGCAAAGGGTGGATGG + Exonic
1167905866 19:52660207-52660229 GCACCTCTGCAGCTGGGGGTAGG + Intronic
925144970 2:1575252-1575274 GCAACTGTGCTGATGGTCGAGGG - Intergenic
925625949 2:5842190-5842212 GCATGTGTGCAGATGGAGGTGGG - Intergenic
926232942 2:11018694-11018716 GCATCTGTTCAGATGGTGGCTGG - Intergenic
926598385 2:14815003-14815025 GCATGTCTTCACATGGTGGCAGG - Intergenic
927707313 2:25304480-25304502 GGATCGCTGCATATGGTGGGCGG - Intronic
930161810 2:48166400-48166422 GCATCTCTGGAACTTGTGGATGG - Intergenic
930394569 2:50804771-50804793 GCATAGCTGCAGATGTTTGAAGG - Intronic
930877213 2:56232578-56232600 GCACCTCTTCACAGGGTGGAAGG - Intronic
932235832 2:70120427-70120449 GATTCTCTGCAGATGGTTCATGG + Intergenic
932585519 2:73025675-73025697 GCAATGCTGCAGAGGGTGGAAGG + Intronic
937322377 2:120968662-120968684 GCATCACTGGGGATGGGGGAGGG - Intronic
939798989 2:146683538-146683560 GCACATCTTCACATGGTGGAAGG + Intergenic
940375495 2:152953790-152953812 GCATCTCTTCACAGGGTGGCAGG + Intergenic
940896910 2:159089655-159089677 TCATCTCTGCTGTTGGTGGTTGG - Intronic
941270009 2:163413866-163413888 ACATGTCTGCAGATTGTTGAGGG + Intergenic
941276318 2:163495150-163495172 GCATCTCTTCACAGGGTGGCAGG - Intergenic
941798042 2:169623132-169623154 CCATCTCTGCATCTGCTGGAAGG - Intronic
943564067 2:189496769-189496791 GCCCCTCTCCAGAAGGTGGAAGG - Intergenic
944307578 2:198195484-198195506 GCATGTCTCCACATGGTGGCAGG + Intronic
945424582 2:209684447-209684469 GCATCACAGCATATGGTCGATGG - Intronic
946370313 2:219277772-219277794 GGATCACTGCGGAGGGTGGAGGG - Intronic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
948478864 2:238238598-238238620 GCAGCTCTGGAGTGGGTGGAGGG - Exonic
948615445 2:239195485-239195507 TCATCTCTGCAGCTGGTGTGTGG - Intronic
948911912 2:241009145-241009167 GCATCTCTGATGGTGGTGGCTGG + Intronic
1168955348 20:1830550-1830572 GCCTCTATGCAGCTGGGGGAAGG + Intergenic
1169861490 20:10157701-10157723 GCATCCCTTCAGATGTTGCAGGG + Intergenic
1170866460 20:20162131-20162153 CCAGCTCTGAAGATGGAGGAAGG - Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1172906133 20:38370867-38370889 GCTTCTCTGTAGCTGGTGGGAGG + Intronic
1173615771 20:44401899-44401921 GTATCCCTGGAGATGGTGGTTGG + Intronic
1174860435 20:54086310-54086332 GAATCTCTGCAGGTGGGAGAAGG + Intergenic
1177259728 21:18713626-18713648 GCACCTCTTCAGAGGGTGGTGGG - Intergenic
1177519087 21:22194062-22194084 GCATGTCTTCACATGGTGGCAGG + Intergenic
1177611888 21:23460483-23460505 GCATATCTTCACATGGTGGCAGG + Intergenic
1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG + Intergenic
1178943396 21:36926121-36926143 TCCTCTCTGCAGATGTTGGTGGG - Intronic
1179446502 21:41435560-41435582 GCATCTCTTCACAAGGTGGCAGG + Intronic
1180091591 21:45536364-45536386 GCATCTCTGCTCTTAGTGGAGGG - Intronic
1181036155 22:20170648-20170670 GCTTCTCTGCTGAGGCTGGATGG - Intergenic
1181347548 22:22230946-22230968 GCATCTCTGGAGGTGGAGGTCGG + Intergenic
1181886629 22:26026957-26026979 GCATCTCTTCAGACGGTGTTGGG + Exonic
1182891684 22:33824352-33824374 GCATGCCTTCACATGGTGGAAGG + Intronic
1184066305 22:42123749-42123771 GCGTCTCTGCAGAGGGAGGTGGG - Intergenic
1184068773 22:42135901-42135923 GCGTCTCTGCAGAGGGAGGTGGG - Intergenic
1184443077 22:44530599-44530621 ACATCTCTTCTGATGGTGGGGGG - Intergenic
1184843663 22:47067485-47067507 GCATCGTTGCAAAGGGTGGAAGG - Intronic
1184899451 22:47435412-47435434 GCATCTCTGCCGTCTGTGGAAGG + Intergenic
1185095415 22:48803640-48803662 GCAGCTGGGAAGATGGTGGAGGG + Intronic
949170889 3:995103-995125 GCATCTCATCAGATGGTGGAAGG - Intergenic
950371056 3:12531027-12531049 GCACCTCTTCAGAGGGTGGCAGG + Intronic
951545288 3:23818801-23818823 GGATGTCTTCAGATGGAGGATGG + Intronic
953753059 3:45624175-45624197 GCATCCCTGCAGATGCTGACTGG + Intronic
953767196 3:45752671-45752693 GCATCACTGAAAATGGTGAATGG - Intergenic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954652736 3:52175342-52175364 GCATCGCTGGAGATGGTGGGAGG - Intergenic
956875876 3:73462695-73462717 ACCTCTCTGCATGTGGTGGAAGG + Intronic
958427637 3:93997682-93997704 GCATGTATGCAGATGGTCTATGG - Intronic
958617197 3:96510527-96510549 GTATCTCTTCAGAGGGTGGCAGG - Intergenic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
962315215 3:134354990-134355012 GCAACTTTGCAGATGGTGATGGG - Intergenic
963878447 3:150502192-150502214 GCATCTCTTCACAGGGTGGCAGG + Intergenic
965956622 3:174377895-174377917 GCATCTCTGCGGATGGTGGAGGG - Intergenic
966244062 3:177786332-177786354 GCATCTCTATAGATGTTTGAGGG - Intergenic
966452442 3:180077638-180077660 GCATGTCTTCACATGGTGGCAGG + Intergenic
967015824 3:185480801-185480823 GCATGTCTTCACATGGTGGTAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967761061 3:193226789-193226811 GCCTCTCTGGAAATGGTCGAAGG - Intergenic
967981707 3:195069813-195069835 GCAGCTGTGCACCTGGTGGAGGG - Exonic
972406198 4:38748686-38748708 GCATGTCTTCACATGGTGGCAGG - Intergenic
972842252 4:42945102-42945124 GCGTGTCTTCACATGGTGGAAGG - Intronic
973761020 4:54115853-54115875 GCATCTTTGCATATGCTTGATGG + Intronic
973766432 4:54167492-54167514 CCATGTCTGCACATGGTGGAAGG + Intronic
974855146 4:67452445-67452467 GCATGTCTTCACATGGTGGCAGG - Intergenic
975663991 4:76715925-76715947 GCATTTTTGCATATGGAGGAGGG + Intronic
977378681 4:96241585-96241607 GCATGTCTTCACATGGTGGAAGG - Intergenic
979519746 4:121652693-121652715 CCATGTCTTCAGATAGTGGAAGG + Intergenic
980521235 4:133937528-133937550 GTAGCTCTGGAGATGCTGGAAGG + Intergenic
980860076 4:138488500-138488522 GTATCTGTGCAGATGGGGAAAGG - Intergenic
980913127 4:139011208-139011230 GAATCTCTGGAGATGGGGTAGGG - Intergenic
981026942 4:140086218-140086240 GCCTATGTGCGGATGGTGGAGGG - Intronic
982296697 4:153836314-153836336 GCACCTCTGGATATGGTTGAAGG - Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
985985654 5:3513971-3513993 GGAACTCTGCAGAGGGTGGGAGG - Intergenic
986004991 5:3660165-3660187 GCATTCCTGCAGAGGGGGGAAGG - Intergenic
986110075 5:4707000-4707022 GCACCTCTTCACATGGTGGCAGG - Intergenic
986132043 5:4941049-4941071 GCATCTCTTCAGTTCGGGGATGG + Intergenic
986303564 5:6498217-6498239 GCATCTCTTCATAGGGTGGCAGG - Intergenic
986343379 5:6812226-6812248 GGATCTGTGCACATGGTGGTAGG - Intergenic
987303936 5:16620404-16620426 GCATCTCTTCACAGGGTGGCAGG - Intergenic
987473517 5:18362032-18362054 GCTTCTATGCAGATGGTTGGTGG + Intergenic
988436953 5:31187328-31187350 GCATCTTTTCAGATGGTCAAGGG + Intergenic
989268703 5:39506703-39506725 GCTTCTATGCAGCTGATGGAGGG - Intergenic
989450131 5:41577222-41577244 CCATGTCTTCACATGGTGGAAGG + Intergenic
990939437 5:61187153-61187175 GCATATCTTCACATGGTGGCAGG - Intergenic
990997269 5:61745337-61745359 GCATATCTGCAGTTTGTGCAGGG + Intronic
991254504 5:64599454-64599476 GCAGCTCAGCAGAAGGTGGAGGG + Intronic
991318339 5:65338538-65338560 GCATGTCTGCTGGTGGTGGAAGG - Intronic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
995981699 5:118112254-118112276 GCATCTCTTCACAGGGTGGCAGG - Intergenic
997430155 5:133832105-133832127 GCTTGTCTGAAGCTGGTGGAGGG + Intergenic
997771719 5:136561134-136561156 GCATGTCTGGAGATGGAGAATGG + Intergenic
997783263 5:136681583-136681605 GCATCTTTGCATATAGTGGTTGG + Intergenic
999816662 5:155183862-155183884 GCATCTCTTCATAGGGTGGTAGG - Intergenic
1003015144 6:2462177-2462199 GCACCTCTGCAGACGGGGGGTGG + Intergenic
1003217175 6:4124907-4124929 GCATCTTTGCAGGTTGTGCAAGG - Intronic
1003626659 6:7747411-7747433 GCACCTTTGAAGATGGAGGAAGG + Intronic
1004777107 6:18860095-18860117 GGATCTCTGGAGATACTGGAGGG + Intergenic
1005508101 6:26487818-26487840 GGATCTATGCTGATGGTGGATGG - Intergenic
1007627424 6:43254453-43254475 ACAGCTCTGCAGCTGGTGAAGGG - Intronic
1007889741 6:45276763-45276785 GCAGCTCTGCTGATTTTGGATGG - Intronic
1009187450 6:60589986-60590008 TCATCTCTGCACAGAGTGGATGG - Intergenic
1009971522 6:70629803-70629825 GCACCTCTTCAGAAGGTGGCAGG - Intergenic
1012233095 6:96783281-96783303 GCATAACTGCAGATAGTTGAGGG - Intergenic
1013286027 6:108682564-108682586 GCCTCTCTGCAGGTGGCTGAGGG - Exonic
1013970502 6:116012300-116012322 GCTTGTGTCCAGATGGTGGAAGG - Intronic
1014550606 6:122785929-122785951 CCATCTCTGCTTCTGGTGGAGGG + Intergenic
1016105667 6:140159084-140159106 GCACATCTTCAGATGGTGGTAGG + Intergenic
1016254146 6:142083696-142083718 GCATGTCTTCACATGGTGGCAGG - Intronic
1016374119 6:143403084-143403106 GCATCCATTCAGATGGTTGAGGG + Intergenic
1016703084 6:147076028-147076050 GCATCACAGCACATGGTGGTTGG + Intergenic
1017243560 6:152197082-152197104 GCATCTGTGCATATCGAGGAAGG - Intronic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1019990809 7:4689335-4689357 GCCTCTCAGCAGATGGAGCATGG - Intronic
1020243410 7:6412667-6412689 GAATCTGATCAGATGGTGGAAGG + Intronic
1020809647 7:12835161-12835183 GCATGTCTTCACATGGTGGCAGG + Intergenic
1022154724 7:27648159-27648181 CCATCTCTGAAGATGGTAAAAGG + Intronic
1022858258 7:34338653-34338675 GCATTTCTTCACATGGTGGCAGG + Intergenic
1028286621 7:89011100-89011122 GCACCTCTTCACATGGTGGCAGG + Intronic
1028320339 7:89451452-89451474 GCATCTCTGCTGGTGGGGAATGG + Intergenic
1029528221 7:101108508-101108530 GCAGCTCTGCAGCAGGTGGAAGG - Intergenic
1030073600 7:105718608-105718630 GCATCTCTGCAGTTGACGGCAGG + Intronic
1031424490 7:121588823-121588845 GGATCTATTCAGATGGTTGAAGG - Intergenic
1031690885 7:124786285-124786307 GCATCTCTTCAGAGGGTGGCAGG - Intronic
1032081428 7:128860380-128860402 GCATTTCAGCACATGGTGGTGGG + Intergenic
1034003707 7:147444950-147444972 GCACGTCTTCACATGGTGGAAGG + Intronic
1034279176 7:149839714-149839736 GCATCACTGTAGCTTGTGGAGGG - Intronic
1034510532 7:151531267-151531289 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1034787751 7:153940952-153940974 CCATCTCTGCACATGGGAGAGGG + Intronic
1035282079 7:157784782-157784804 GCCTCTCTGCAGCTAATGGAAGG + Intronic
1037586914 8:20283344-20283366 CTATGTCTTCAGATGGTGGAAGG - Intronic
1040477086 8:47788267-47788289 GCAAGTCTCCAGATGGAGGAGGG + Intronic
1041264279 8:56048578-56048600 GGATCTCTGTAAATTGTGGATGG - Intergenic
1041623729 8:60001252-60001274 ACATACCTGCAGATGGTGGCTGG - Intergenic
1041663050 8:60417351-60417373 GGCTCTCTGCATATGGTGCACGG - Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044362481 8:91304411-91304433 GCATGTCTTCACATGGTGGCAGG - Intronic
1045714115 8:105021578-105021600 CCATGTCTTCACATGGTGGAAGG - Intronic
1045790791 8:105981328-105981350 GCATATCTGCTGCTGTTGGATGG - Intergenic
1046248659 8:111601022-111601044 GCATCTCATCACATGGTGGCAGG + Intergenic
1046268015 8:111857619-111857641 GCATGTCTTCACATGGTGGCAGG - Intergenic
1046453885 8:114433177-114433199 CCATTTCTCCAGATTGTGGAGGG + Intergenic
1048427589 8:134337030-134337052 CCACCTCTTCAGACGGTGGACGG + Intergenic
1048828814 8:138456388-138456410 GCATTTCTGAAGAGGGTGAAGGG + Intronic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049353257 8:142175453-142175475 GCATCCCTGCAGGTGCTGGGTGG - Intergenic
1049843739 8:144789892-144789914 GCATCTCTGCGGATGGTGGAGGG + Exonic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1053242091 9:36504348-36504370 GCCAGTCTGCAGATGGTGGCGGG + Intergenic
1054813432 9:69452611-69452633 GGATCTGTGAAGATGGTGCAGGG - Intronic
1055140700 9:72874098-72874120 GCATATCTTCACATGGTGGCCGG + Intergenic
1058620106 9:106873825-106873847 GCTTTTCTGCAAATGGTGGTTGG + Intronic
1059945454 9:119404534-119404556 GCATGTGTGTAGATGGTGGGGGG - Intergenic
1062678471 9:137762724-137762746 GCCTCTCTGCAGCTGCCGGATGG + Exonic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186551689 X:10512641-10512663 CCATCTTTGCAGGTGTTGGAAGG - Intronic
1186732895 X:12429276-12429298 GCATCTCCACTGATTGTGGAAGG + Intronic
1187485112 X:19695731-19695753 GTATCTCTGCAGGTAGAGGAAGG - Exonic
1188974014 X:36651963-36651985 GCACCTCTTCACATGGTGGCAGG + Intergenic
1189369024 X:40413144-40413166 GCATATCTGTATATAGTGGAAGG - Intergenic
1189634538 X:42992139-42992161 GGGTCTGTGCAGTTGGTGGAGGG - Intergenic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1193436459 X:81479559-81479581 GCATTTCTGCAGATGGACAAAGG + Intergenic
1195501224 X:105602033-105602055 GCAGCTCTGCGGCTGGAGGAGGG - Intronic
1195608490 X:106836185-106836207 GCACCTCTTCACAGGGTGGAAGG + Intronic
1196305972 X:114103818-114103840 GCATTTAGGCAGATGGGGGAGGG - Intergenic
1196662898 X:118286581-118286603 GCATTTCTGCTGATGATGAATGG + Intergenic
1198203006 X:134440705-134440727 AAATCTCTGCAGATGGTGGGAGG + Intergenic
1198855110 X:141007383-141007405 GCATCTCAGGAGATGTTCGATGG + Intergenic
1198876903 X:141237757-141237779 GCATCTCAGGAGATGTTCGATGG - Intergenic
1198907581 X:141579986-141580008 GCATCTCAGGAGATGTTCGATGG - Intergenic
1198909210 X:141594438-141594460 GCATCTCAGGAGATGTTCGATGG + Intronic
1198917866 X:141693713-141693735 GCATCTCAGGAGATGTTCGATGG - Intronic
1199676009 X:150189932-150189954 GCATATCTGTTGATGGGGGATGG - Intergenic
1199845152 X:151687554-151687576 GAATCTCTGAACCTGGTGGAGGG + Intergenic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic