ID: 1178190076

View in Genome Browser
Species Human (GRCh38)
Location 21:30270021-30270043
Sequence CTGGATCTTCATATCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178190071_1178190076 17 Left 1178190071 21:30269981-30270003 CCTTTTATTTTATGGCTGTAGAA No data
Right 1178190076 21:30270021-30270043 CTGGATCTTCATATCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178190076 Original CRISPR CTGGATCTTCATATCAGGAG GGG Intergenic
No off target data available for this crispr