ID: 1178195675

View in Genome Browser
Species Human (GRCh38)
Location 21:30342286-30342308
Sequence AAATTTATGCAGTGAGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178195675_1178195677 1 Left 1178195675 21:30342286-30342308 CCATCAACTCACTGCATAAATTT No data
Right 1178195677 21:30342310-30342332 GACAAGTCACTCTACCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178195675 Original CRISPR AAATTTATGCAGTGAGTTGA TGG (reversed) Intergenic
No off target data available for this crispr