ID: 1178197661

View in Genome Browser
Species Human (GRCh38)
Location 21:30367020-30367042
Sequence GAGGCTCATAACTTCAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178197661 Original CRISPR GAGGCTCATAACTTCAAGTG TGG (reversed) Intronic
906660500 1:47578274-47578296 GAGGCTCATAAATCCACCTGAGG + Intergenic
912905034 1:113696184-113696206 GGGGATAATAACTACAAGTGGGG - Intergenic
913322991 1:117602849-117602871 CAGGATCATCACTACAAGTGAGG + Intergenic
1066982691 10:42433503-42433525 GAGGCTCTTAACTTCCACAGAGG + Intergenic
1068954718 10:62812778-62812800 GATGCTGATCCCTTCAAGTGGGG - Exonic
1069885310 10:71619906-71619928 GAGGCTCATTACTTTACCTGAGG - Intronic
1070430788 10:76335646-76335668 AAGGCAGATAACTTTAAGTGGGG + Intronic
1072606527 10:96988187-96988209 GAGGCTCAGGACCCCAAGTGAGG - Intergenic
1073498455 10:103915417-103915439 GATTCGCATAAATTCAAGTGTGG + Intronic
1080649655 11:34211989-34212011 GAGGCCCAAAAATTCAAATGGGG + Intronic
1087599902 11:100300555-100300577 GAAGCTCATAGCTTCATGGGGGG - Intronic
1087772483 11:102225789-102225811 GAGGCTCACAACTTCAAGGAGGG - Intronic
1089032549 11:115347375-115347397 GGTGCTAATAACTCCAAGTGGGG - Intronic
1092380225 12:7990114-7990136 AAGACTCATAACTTCCTGTGGGG + Intergenic
1094809903 12:34126648-34126670 GAGGCTCATTTCATCCAGTGAGG - Intergenic
1100443901 12:94643211-94643233 GAGGCACATAACTCCAAGACTGG + Intronic
1101186156 12:102282256-102282278 GAGGATCATAACTTCAAAGATGG + Intergenic
1104053062 12:125209279-125209301 GAGGCTCACATCTCTAAGTGGGG + Intronic
1109017384 13:57035274-57035296 AAAGCTCATAACTGCAAATGAGG - Intergenic
1114437113 14:22715298-22715320 GTGGCTCATAACCTCCAGGGGGG + Intergenic
1124561031 15:30773793-30773815 GAGGCTCATAAATCCAAGCGTGG + Intergenic
1124669499 15:31625266-31625288 GAGGCTCATAAATCCAAGCGTGG - Intronic
1125421632 15:39510389-39510411 AAGGCTTATAACTAGAAGTGAGG - Intergenic
1127377178 15:58395516-58395538 CATCCTCATAACTCCAAGTGTGG + Intronic
1129576643 15:76756013-76756035 GAGGCAGATAACTTCAGGTCCGG + Intronic
1135681321 16:24459786-24459808 GATGTTCATAAGGTCAAGTGGGG - Intergenic
1138672980 16:58630159-58630181 GAGGCTGATAACTTCGATTTGGG + Intergenic
1145203397 17:20967186-20967208 GAGGTTGACAACTCCAAGTGTGG + Intergenic
1146025103 17:29313629-29313651 GAGGCTCATCACTTGAGGTCAGG - Intergenic
1152078805 17:78174148-78174170 GGGGCTTATCTCTTCAAGTGTGG - Exonic
1152800429 17:82328300-82328322 GAGGCTCATCACTGCCTGTGGGG - Intronic
1152801271 17:82331836-82331858 GAGCCTCAAAACTTCTAGAGTGG + Intronic
1154009436 18:10562462-10562484 AAGGCTCATACCTTCACCTGTGG - Intergenic
1157850543 18:51045073-51045095 GAGGCTCAAAACTACAACAGTGG + Intronic
1159507715 18:69357979-69358001 GTGGCTGATAAGTTCAAGTATGG - Intergenic
1160272275 18:77397909-77397931 GATCCTCAGAACTTCAAGTTAGG + Intergenic
1160363294 18:78302671-78302693 GTAGCTCATCACTCCAAGTGGGG - Intergenic
1164407359 19:27963082-27963104 GAGGCTCTTAAATTCAATAGAGG - Intergenic
1164919844 19:32081010-32081032 GAGTCTAATATCTTCAACTGTGG + Intergenic
1167855221 19:52231941-52231963 GAGGCCCAAAAGATCAAGTGGGG - Intergenic
1167889161 19:52526332-52526354 CAGGCAAATAACTTAAAGTGAGG + Intergenic
1168689133 19:58366453-58366475 GATGCTCAGAGCTTCCAGTGGGG - Intergenic
925872305 2:8282038-8282060 AAGTCTCAAGACTTCAAGTGAGG + Intergenic
930913120 2:56654806-56654828 GAATCTCATTACTTCATGTGTGG + Intergenic
931367355 2:61630356-61630378 GGTGTTCATACCTTCAAGTGGGG - Intergenic
931876409 2:66518091-66518113 GAGGTGCATAACTACAAGTGGGG - Intronic
932506518 2:72237782-72237804 GAGGCTGCTGACTTGAAGTGTGG + Intronic
932893247 2:75613775-75613797 GAGGATCATAACTTCACTTAGGG - Intergenic
933250977 2:80028057-80028079 GAGGCTCAGAAGATGAAGTGTGG + Intronic
937160997 2:119760436-119760458 GAGGCTCTTACCTGCATGTGTGG + Intronic
947035382 2:225847914-225847936 GGGGCTCAAGACTTCAAGGGAGG - Intergenic
1172116959 20:32578820-32578842 AAGGCTCTGAACTTGAAGTGAGG - Intronic
1175660814 20:60810439-60810461 GTGGGTCATAGGTTCAAGTGTGG + Intergenic
1175774893 20:61646906-61646928 TTGGCTCAAAACTGCAAGTGTGG + Intronic
1178197661 21:30367020-30367042 GAGGCTCATAACTTCAAGTGTGG - Intronic
1182117279 22:27764056-27764078 GAGGCTGCAAAATTCAAGTGAGG + Intronic
1182361101 22:29747004-29747026 GAGGCTCAGAGGTTCAAGTGAGG - Intronic
1185104568 22:48860039-48860061 GAAGATCATAGCTTCAGGTGTGG + Intergenic
950045304 3:9945594-9945616 GAGGCTCATCACTCCACGTTGGG + Exonic
950769644 3:15301293-15301315 AATGCTCATGACTTCAAGGGAGG + Intronic
959466609 3:106695314-106695336 GAAGCTCCTAACTGCAAGTAGGG - Intergenic
962603924 3:137015915-137015937 AAGACTCAAAAGTTCAAGTGAGG - Intergenic
964888263 3:161509472-161509494 GAAGGGCATAACTTCAAATGAGG - Intergenic
965762288 3:172092518-172092540 GAGGCTCATAATTTCAGGTATGG + Intronic
967022033 3:185531254-185531276 AAGACTCATAAGTTCAGGTGCGG + Intronic
969973528 4:11073358-11073380 GAGGATAGTAACTTCCAGTGTGG + Intergenic
970120194 4:12745271-12745293 AAAGTTCATAGCTTCAAGTGAGG + Intergenic
971299381 4:25429125-25429147 GAGGCTTCTAACTAGAAGTGGGG + Intergenic
972851219 4:43053194-43053216 AAGGCTCATACCTTCCAGAGTGG - Intergenic
973922631 4:55704320-55704342 GAGGCTCATAACCTAGAGGGAGG + Intergenic
977563706 4:98560480-98560502 GAGACTAATATCTTCAATTGAGG + Intronic
980152599 4:129066091-129066113 GAGGCTCATATATGCTAGTGAGG + Intronic
981340992 4:143621026-143621048 GAGCCTCATACCTTGACGTGTGG + Exonic
985253742 4:188048728-188048750 GATGCTCATTCCTCCAAGTGCGG - Intergenic
989303794 5:39927565-39927587 GGAACTCATACCTTCAAGTGGGG - Intergenic
990672122 5:58143839-58143861 GAGACCAATGACTTCAAGTGGGG - Intergenic
996791158 5:127294496-127294518 GAAGTTAATAACTTCAAGTGGGG + Intronic
997101440 5:130973644-130973666 GAGGATCACACCTTCAACTGAGG - Intergenic
998677563 5:144426700-144426722 GAGGGTCATACCATCAAGGGAGG + Intronic
1006624228 6:35385929-35385951 GAGGATCATCATTTCAAGGGCGG + Intronic
1006847522 6:37072848-37072870 CAGGCTCAGAAATTCAAGTAGGG - Intergenic
1010064887 6:71670757-71670779 GGGGCTCAAAACTTCAATGGAGG + Intergenic
1010273883 6:73947384-73947406 GAATCTCAGAACTTCAAGTTAGG - Intergenic
1011323788 6:86126563-86126585 TAGGCTCATAACTTCTATTCTGG - Intergenic
1013930398 6:115523871-115523893 AAGGCTCTTAACTTTCAGTGAGG + Intergenic
1016764000 6:147772309-147772331 GATGCTCAGAACTTCAAGAAAGG + Intergenic
1021593169 7:22286860-22286882 AATGCTCAGAACTTCAAGGGTGG + Intronic
1038302380 8:26364876-26364898 GAGGGCCAAAACTTCACGTGTGG + Intronic
1039791349 8:40878271-40878293 GAGCCACCTGACTTCAAGTGAGG - Intronic
1050132817 9:2430222-2430244 GAGGCTCATAACAATAAGAGAGG + Intergenic
1051315660 9:15828173-15828195 GATGATCATAAATTCTAGTGAGG + Intronic
1052788224 9:32849866-32849888 GAGGCTTAAAACTTCAAGTACGG + Intergenic
1056106513 9:83352539-83352561 GAGCCTCAGAGCTTGAAGTGAGG - Intronic
1189072541 X:37879326-37879348 TGGGCTCATGACTTCAATTGAGG + Intronic
1189356826 X:40316225-40316247 GGGGATCATATCTGCAAGTGAGG + Intergenic
1189655804 X:43244161-43244183 CAGCCTCATCACTTCAACTGGGG - Intergenic
1192830419 X:74745281-74745303 GAGGCTTAGAACTTCTAGAGTGG - Intronic
1200866327 Y:8047626-8047648 GAGTCACATCACTTCAAGTTTGG - Intergenic
1200869799 Y:8085170-8085192 AAGTCTCATCACTTCAAGTTTGG + Intergenic