ID: 1178202709

View in Genome Browser
Species Human (GRCh38)
Location 21:30425856-30425878
Sequence CAAGTAACCCCCGTGGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178202705_1178202709 0 Left 1178202705 21:30425833-30425855 CCACAGGAGGAGCCTGGGTAGTG 0: 1
1: 1
2: 1
3: 22
4: 242
Right 1178202709 21:30425856-30425878 CAAGTAACCCCCGTGGGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 90
1178202700_1178202709 23 Left 1178202700 21:30425810-30425832 CCAGGTTGCTGGGGTAGGAAGAG 0: 1
1: 2
2: 3
3: 20
4: 315
Right 1178202709 21:30425856-30425878 CAAGTAACCCCCGTGGGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178202709 Original CRISPR CAAGTAACCCCCGTGGGAGC AGG Exonic
901169413 1:7245907-7245929 CAAGTCACCACTGTGGGAACTGG + Intronic
902814585 1:18908885-18908907 GAAGAAAGCCCCTTGGGAGCTGG + Intronic
909393108 1:75137097-75137119 CAGGTGAGCCCCGAGGGAGCGGG + Exonic
911233191 1:95382215-95382237 AAAGTCACCCCCGGGGAAGCTGG - Intergenic
917869787 1:179230647-179230669 CAAGTAAACACAGTGGGAGAGGG - Intergenic
1063101270 10:2951972-2951994 CAAGTTACCCCAGTGTGGGCAGG - Intergenic
1078421214 11:11214642-11214664 CAAGTTACACCTGTGGGTGCAGG + Intergenic
1081801849 11:45865513-45865535 CAGGTAACCCCTGTGGTATCAGG - Intronic
1084422689 11:69068252-69068274 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422711 11:69068369-69068391 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422725 11:69068447-69068469 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422732 11:69068486-69068508 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422746 11:69068564-69068586 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422753 11:69068603-69068625 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422767 11:69068681-69068703 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422774 11:69068720-69068742 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422790 11:69068798-69068820 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422824 11:69068993-69069015 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422830 11:69069032-69069054 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422844 11:69069110-69069132 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422850 11:69069149-69069171 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422863 11:69069226-69069248 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422877 11:69069304-69069326 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422884 11:69069343-69069365 GAAGTTACCGCAGTGGGAGCAGG + Intronic
1084422892 11:69069382-69069404 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422899 11:69069421-69069443 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422913 11:69069499-69069521 GAAGTTACCGCAGTGGGAGCAGG + Intronic
1084422934 11:69069616-69069638 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1084422941 11:69069655-69069677 GAAGTGACCGCAGTGGGAGCAGG + Intronic
1089602112 11:119622682-119622704 CTAGCAGCCCCCGTGTGAGCTGG - Intergenic
1089879836 11:121762979-121763001 CAAGCAAGCCCCGTGGAACCTGG + Intergenic
1092038685 12:5363989-5364011 CAGGTAACCTCAGCGGGAGCCGG + Intergenic
1099948790 12:89276732-89276754 GAAGCAACCTCCGTGAGAGCAGG - Intergenic
1102237895 12:111306120-111306142 TAATTAACCCCCGTGGAACCCGG + Intronic
1102450607 12:113039180-113039202 AAAGTAACCCCCGTTGGTGAGGG - Intergenic
1118734983 14:68694834-68694856 CAAGGAGCTCCCCTGGGAGCTGG + Intronic
1120788076 14:88554906-88554928 CAAAGAAGCCCCGTGGGGGCGGG + Intergenic
1120843561 14:89107423-89107445 CAAATCACCCCAGTGGGTGCTGG + Intergenic
1122771264 14:104098977-104098999 CAAGTAAGCCCCGCAGGAGCAGG + Exonic
1125363909 15:38893232-38893254 GATGTAAGCCCCGTGGAAGCTGG - Intergenic
1142357405 16:89608404-89608426 CAAGTGACTCCAGAGGGAGCCGG - Intergenic
1142595428 17:1027482-1027504 CAAGCAAGCCTCTTGGGAGCTGG + Intronic
1146655599 17:34632917-34632939 CAAGTATCCGCCATGGGAGAGGG - Intronic
1147350158 17:39835954-39835976 CAACAAACCTCCGTGGCAGCTGG - Intronic
1162094490 19:8302516-8302538 CCAGTAACCCCAGTGGGCGGAGG + Exonic
1162860570 19:13503828-13503850 CAAGAAAGCCCCGGGCGAGCTGG + Intronic
1164464509 19:28476030-28476052 GAAGTAAGCCCCATGGGAGGAGG - Intergenic
1164604835 19:29590333-29590355 CAAGTAGTCACAGTGGGAGCAGG + Intergenic
1165104580 19:33461469-33461491 CCAGTAGCCACCTTGGGAGCAGG + Intronic
925118171 2:1397899-1397921 CAGGTACGCCCCATGGGAGCTGG - Intronic
934770784 2:96906665-96906687 CAACAGACCCCCGTGGGTGCAGG + Intronic
936281804 2:111147893-111147915 AAGGTAAGCCCCGTGGGAGCAGG + Intronic
937145488 2:119640777-119640799 CAGGTTACCCGAGTGGGAGCTGG - Intronic
948685412 2:239666730-239666752 CAGGAAACTCCCGTGGGAGGAGG - Intergenic
1170940842 20:20846685-20846707 AATGTCACCCCCGAGGGAGCAGG - Intergenic
1173456821 20:43209444-43209466 CCAGTCACTGCCGTGGGAGCTGG + Intergenic
1174109988 20:48192320-48192342 CAAGTCGCCCCAGTTGGAGCTGG - Intergenic
1174302770 20:49594291-49594313 CCAGAAACCACCGAGGGAGCTGG + Intergenic
1178202709 21:30425856-30425878 CAAGTAACCCCCGTGGGAGCAGG + Exonic
1178579679 21:33827888-33827910 CATGTAAGCCCAGTTGGAGCTGG - Intronic
1180059570 21:45377794-45377816 CAAGTAGCCCCCATAAGAGCAGG - Intergenic
1181580093 22:23823345-23823367 CAAGCAAACCACGTGGGTGCTGG - Intronic
1181841803 22:25669663-25669685 CAAATAACCCCCGTGGAGACAGG + Intronic
1182043081 22:27253577-27253599 CAAGAAACACCCAGGGGAGCAGG + Intergenic
1185272760 22:49936297-49936319 AAAGGAGCCCCCGCGGGAGCAGG + Intergenic
954193206 3:48979376-48979398 CAGGTGACCCCTTTGGGAGCAGG + Intronic
955161363 3:56468084-56468106 CAAGAAAGCCCCGTAGGAGGCGG + Intronic
956506342 3:69944297-69944319 CTGGTAACCCCCGTGAGAACAGG - Intronic
964206323 3:154178897-154178919 AAAGTAACCCTGGAGGGAGCAGG - Intronic
969660582 4:8525268-8525290 CAAGGAACCCCGCTGGGAGAAGG + Intergenic
970343628 4:15131795-15131817 TAAGTTACCCTCCTGGGAGCAGG + Intergenic
973019838 4:45188606-45188628 CCATTTACCCCTGTGGGAGCCGG + Intergenic
973809167 4:54553476-54553498 CAAGTTACCAGCGTGGAAGCTGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
992762404 5:79962278-79962300 CATGTAAGCCCCGGGGGTGCTGG + Intergenic
996167466 5:120242846-120242868 AAAATAAACACCGTGGGAGCTGG + Intergenic
998819265 5:146043316-146043338 CAAGTAACCCTCATGGTAGGGGG - Intronic
1003067789 6:2918328-2918350 CAAGGAAGCCCAGTGGGAGTGGG + Intergenic
1005535742 6:26754647-26754669 CAAGGAACCCAGGTGTGAGCAGG + Intergenic
1007227325 6:40324375-40324397 CAAGCAGCCCCCTGGGGAGCTGG - Intergenic
1016031623 6:139344135-139344157 CAAATAACCCCAGTAGGAGCTGG - Intergenic
1018811585 6:167301958-167301980 CAAGAAACACCTGTGGCAGCAGG + Intronic
1020492892 7:8811298-8811320 GCAGTCACCCCTGTGGGAGCAGG - Intergenic
1023637737 7:42228996-42229018 CCTCTAACCCCCATGGGAGCAGG + Intronic
1030916888 7:115326077-115326099 CAACTAACCCCTGTCGGAACAGG - Intergenic
1033713034 7:143968995-143969017 GAAGTAACCCAAGTGGGAGATGG - Intergenic
1048131309 8:131700618-131700640 CAAGGATCCCCCATGAGAGCTGG - Intergenic
1048131487 8:131702549-131702571 CAAGAATCCTTCGTGGGAGCTGG - Intergenic
1049237649 8:141520148-141520170 CAAGTTACCCCTGTGGGCACTGG + Intergenic
1049243239 8:141549223-141549245 CATGTGGCCCCCGAGGGAGCAGG + Intergenic
1053295640 9:36911202-36911224 CAAGTAAGCCCAGTGAGGGCAGG + Intronic
1053309708 9:37009859-37009881 CAAGTGGCCCCCTTGGAAGCTGG + Intronic
1061672854 9:132198774-132198796 CAGGTAACCCCCGGGGAACCAGG - Intronic
1061962313 9:133994277-133994299 CAAGCAAGTCCAGTGGGAGCCGG - Intergenic