ID: 1178203587

View in Genome Browser
Species Human (GRCh38)
Location 21:30437050-30437072
Sequence ATCCACATGGCACATAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178203581_1178203587 13 Left 1178203581 21:30437014-30437036 CCTGGGGACTTATATGCCCTTAA No data
Right 1178203587 21:30437050-30437072 ATCCACATGGCACATAAAATAGG No data
1178203584_1178203587 -3 Left 1178203584 21:30437030-30437052 CCCTTAACATTGGGTGTGTCATC No data
Right 1178203587 21:30437050-30437072 ATCCACATGGCACATAAAATAGG No data
1178203585_1178203587 -4 Left 1178203585 21:30437031-30437053 CCTTAACATTGGGTGTGTCATCC No data
Right 1178203587 21:30437050-30437072 ATCCACATGGCACATAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178203587 Original CRISPR ATCCACATGGCACATAAAAT AGG Intergenic
No off target data available for this crispr