ID: 1178206092

View in Genome Browser
Species Human (GRCh38)
Location 21:30468329-30468351
Sequence CAGAGATACCACGTGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178206092_1178206097 22 Left 1178206092 21:30468329-30468351 CCTCCTTTCACGTGGTATCTCTG No data
Right 1178206097 21:30468374-30468396 AAGACTCAATATGATGTGAAAGG No data
1178206092_1178206095 -1 Left 1178206092 21:30468329-30468351 CCTCCTTTCACGTGGTATCTCTG No data
Right 1178206095 21:30468351-30468373 GAGGTCGAAATTCAGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178206092 Original CRISPR CAGAGATACCACGTGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr