ID: 1178209321

View in Genome Browser
Species Human (GRCh38)
Location 21:30510374-30510396
Sequence CCATTGCCACAGCTATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178209317_1178209321 15 Left 1178209317 21:30510336-30510358 CCTAACAGGATGAGTGGCTGCAG No data
Right 1178209321 21:30510374-30510396 CCATTGCCACAGCTATACCCTGG No data
1178209316_1178209321 16 Left 1178209316 21:30510335-30510357 CCCTAACAGGATGAGTGGCTGCA No data
Right 1178209321 21:30510374-30510396 CCATTGCCACAGCTATACCCTGG No data
1178209314_1178209321 25 Left 1178209314 21:30510326-30510348 CCATGTCTTCCCTAACAGGATGA No data
Right 1178209321 21:30510374-30510396 CCATTGCCACAGCTATACCCTGG No data
1178209318_1178209321 -8 Left 1178209318 21:30510359-30510381 CCGTATCTATAGCCTCCATTGCC No data
Right 1178209321 21:30510374-30510396 CCATTGCCACAGCTATACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178209321 Original CRISPR CCATTGCCACAGCTATACCC TGG Intergenic
No off target data available for this crispr