ID: 1178209881

View in Genome Browser
Species Human (GRCh38)
Location 21:30517503-30517525
Sequence CAGAGTGAACAGCATGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178209881_1178209882 14 Left 1178209881 21:30517503-30517525 CCACAATCATGCTGTTCACTCTG No data
Right 1178209882 21:30517540-30517562 GTTGCCACTCCTAGTTCTTGTGG No data
1178209881_1178209885 29 Left 1178209881 21:30517503-30517525 CCACAATCATGCTGTTCACTCTG No data
Right 1178209885 21:30517555-30517577 TCTTGTGGAATTTTCCAATTAGG No data
1178209881_1178209886 30 Left 1178209881 21:30517503-30517525 CCACAATCATGCTGTTCACTCTG No data
Right 1178209886 21:30517556-30517578 CTTGTGGAATTTTCCAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178209881 Original CRISPR CAGAGTGAACAGCATGATTG TGG (reversed) Intergenic
No off target data available for this crispr