ID: 1178213593

View in Genome Browser
Species Human (GRCh38)
Location 21:30567794-30567816
Sequence AAACATCACTAAAGCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178213593_1178213596 2 Left 1178213593 21:30567794-30567816 CCATCAAGGCTTTAGTGATGTTT No data
Right 1178213596 21:30567819-30567841 GGCATGTTGGAGTCACATTGAGG No data
1178213593_1178213599 22 Left 1178213593 21:30567794-30567816 CCATCAAGGCTTTAGTGATGTTT No data
Right 1178213599 21:30567839-30567861 AGGGACTCAAGTGTTTTTCAGGG No data
1178213593_1178213600 28 Left 1178213593 21:30567794-30567816 CCATCAAGGCTTTAGTGATGTTT No data
Right 1178213600 21:30567845-30567867 TCAAGTGTTTTTCAGGGCAAAGG No data
1178213593_1178213597 3 Left 1178213593 21:30567794-30567816 CCATCAAGGCTTTAGTGATGTTT No data
Right 1178213597 21:30567820-30567842 GCATGTTGGAGTCACATTGAGGG No data
1178213593_1178213598 21 Left 1178213593 21:30567794-30567816 CCATCAAGGCTTTAGTGATGTTT No data
Right 1178213598 21:30567838-30567860 GAGGGACTCAAGTGTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178213593 Original CRISPR AAACATCACTAAAGCCTTGA TGG (reversed) Intergenic
No off target data available for this crispr