ID: 1178213598

View in Genome Browser
Species Human (GRCh38)
Location 21:30567838-30567860
Sequence GAGGGACTCAAGTGTTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178213593_1178213598 21 Left 1178213593 21:30567794-30567816 CCATCAAGGCTTTAGTGATGTTT No data
Right 1178213598 21:30567838-30567860 GAGGGACTCAAGTGTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178213598 Original CRISPR GAGGGACTCAAGTGTTTTTC AGG Intergenic
No off target data available for this crispr