ID: 1178215723

View in Genome Browser
Species Human (GRCh38)
Location 21:30595586-30595608
Sequence CTGGATTTAGAAATTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178215723_1178215724 -8 Left 1178215723 21:30595586-30595608 CCTTTGTCAATTTCTAAATCCAG No data
Right 1178215724 21:30595601-30595623 AAATCCAGAGTTATCAGTTTTGG No data
1178215723_1178215730 29 Left 1178215723 21:30595586-30595608 CCTTTGTCAATTTCTAAATCCAG No data
Right 1178215730 21:30595638-30595660 CTAGATTTTTTTTTACAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178215723 Original CRISPR CTGGATTTAGAAATTGACAA AGG (reversed) Intergenic
No off target data available for this crispr