ID: 1178231315

View in Genome Browser
Species Human (GRCh38)
Location 21:30788095-30788117
Sequence CACCCTACTCCCCATAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178231315_1178231321 27 Left 1178231315 21:30788095-30788117 CCAATTTTATGGGGAGTAGGGTG No data
Right 1178231321 21:30788145-30788167 TTGAGCAGGGTCTAAATTAGAGG No data
1178231315_1178231322 28 Left 1178231315 21:30788095-30788117 CCAATTTTATGGGGAGTAGGGTG No data
Right 1178231322 21:30788146-30788168 TGAGCAGGGTCTAAATTAGAGGG No data
1178231315_1178231318 13 Left 1178231315 21:30788095-30788117 CCAATTTTATGGGGAGTAGGGTG No data
Right 1178231318 21:30788131-30788153 CTAATTCTGTCTCCTTGAGCAGG No data
1178231315_1178231319 14 Left 1178231315 21:30788095-30788117 CCAATTTTATGGGGAGTAGGGTG No data
Right 1178231319 21:30788132-30788154 TAATTCTGTCTCCTTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178231315 Original CRISPR CACCCTACTCCCCATAAAAT TGG (reversed) Intergenic
No off target data available for this crispr