ID: 1178232218

View in Genome Browser
Species Human (GRCh38)
Location 21:30799100-30799122
Sequence GCTTCTCTGGAGACTGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178232213_1178232218 8 Left 1178232213 21:30799069-30799091 CCAGGGGTGGTGGTGTGCACCTG 0: 22
1: 1828
2: 11530
3: 37134
4: 78401
Right 1178232218 21:30799100-30799122 GCTTCTCTGGAGACTGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178232218 Original CRISPR GCTTCTCTGGAGACTGAGTG AGG Intergenic
No off target data available for this crispr