ID: 1178234078

View in Genome Browser
Species Human (GRCh38)
Location 21:30821735-30821757
Sequence GTCTTCAAAGGACAACCGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178234078_1178234089 14 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234089 21:30821772-30821794 CAAGAAATGGCTGGGTGGGAGGG No data
1178234078_1178234090 18 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234090 21:30821776-30821798 AAATGGCTGGGTGGGAGGGCTGG No data
1178234078_1178234094 30 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234094 21:30821788-30821810 GGGAGGGCTGGGGTGCAGGCAGG No data
1178234078_1178234082 1 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234082 21:30821759-30821781 GAAGGGACACAGCCAAGAAATGG No data
1178234078_1178234085 9 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234085 21:30821767-30821789 ACAGCCAAGAAATGGCTGGGTGG No data
1178234078_1178234086 10 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234086 21:30821768-30821790 CAGCCAAGAAATGGCTGGGTGGG No data
1178234078_1178234084 6 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234084 21:30821764-30821786 GACACAGCCAAGAAATGGCTGGG No data
1178234078_1178234093 26 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234093 21:30821784-30821806 GGGTGGGAGGGCTGGGGTGCAGG No data
1178234078_1178234083 5 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234083 21:30821763-30821785 GGACACAGCCAAGAAATGGCTGG No data
1178234078_1178234092 20 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234092 21:30821778-30821800 ATGGCTGGGTGGGAGGGCTGGGG No data
1178234078_1178234088 13 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234088 21:30821771-30821793 CCAAGAAATGGCTGGGTGGGAGG No data
1178234078_1178234091 19 Left 1178234078 21:30821735-30821757 CCGTGCGGTTGTCCTTTGAAGAC No data
Right 1178234091 21:30821777-30821799 AATGGCTGGGTGGGAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178234078 Original CRISPR GTCTTCAAAGGACAACCGCA CGG (reversed) Intergenic
No off target data available for this crispr