ID: 1178240570

View in Genome Browser
Species Human (GRCh38)
Location 21:30894895-30894917
Sequence CAGCTTGGACAACTTCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178240570_1178240578 19 Left 1178240570 21:30894895-30894917 CCACTGTGAAGTTGTCCAAGCTG No data
Right 1178240578 21:30894937-30894959 CCACCTCCCCTTCATCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178240570 Original CRISPR CAGCTTGGACAACTTCACAG TGG (reversed) Intergenic
No off target data available for this crispr