ID: 1178244706

View in Genome Browser
Species Human (GRCh38)
Location 21:30939158-30939180
Sequence TGGGAGACTTTGGAAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178244697_1178244706 28 Left 1178244697 21:30939107-30939129 CCACAAAGCTGTGTACATAAAGT No data
Right 1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178244706 Original CRISPR TGGGAGACTTTGGAAAAAAC TGG Intergenic
No off target data available for this crispr