ID: 1178254790

View in Genome Browser
Species Human (GRCh38)
Location 21:31042193-31042215
Sequence TAGCCACGGCTGGTACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178254781_1178254790 16 Left 1178254781 21:31042154-31042176 CCTAACTTGGCCTCTCCAACATA No data
Right 1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG No data
1178254782_1178254790 6 Left 1178254782 21:31042164-31042186 CCTCTCCAACATATTTAATGACT No data
Right 1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG No data
1178254786_1178254790 1 Left 1178254786 21:31042169-31042191 CCAACATATTTAATGACTGGGGC No data
Right 1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG No data
1178254780_1178254790 20 Left 1178254780 21:31042150-31042172 CCTTCCTAACTTGGCCTCTCCAA No data
Right 1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178254790 Original CRISPR TAGCCACGGCTGGTACAGGC TGG Intergenic
No off target data available for this crispr