ID: 1178255979

View in Genome Browser
Species Human (GRCh38)
Location 21:31052947-31052969
Sequence TTAGCCCATTATGATTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178255979_1178255985 28 Left 1178255979 21:31052947-31052969 CCTGATAAATCATAATGGGCTAA No data
Right 1178255985 21:31052998-31053020 CATCTGAGAGAGGCAGTGGAAGG No data
1178255979_1178255983 18 Left 1178255979 21:31052947-31052969 CCTGATAAATCATAATGGGCTAA No data
Right 1178255983 21:31052988-31053010 CATGAGTAAGCATCTGAGAGAGG No data
1178255979_1178255984 24 Left 1178255979 21:31052947-31052969 CCTGATAAATCATAATGGGCTAA No data
Right 1178255984 21:31052994-31053016 TAAGCATCTGAGAGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178255979 Original CRISPR TTAGCCCATTATGATTTATC AGG (reversed) Intergenic
No off target data available for this crispr