ID: 1178255981

View in Genome Browser
Species Human (GRCh38)
Location 21:31052977-31052999
Sequence TGCTTACTCATGGATCACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178255981_1178255987 3 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255987 21:31053003-31053025 GAGAGAGGCAGTGGAAGGATGGG No data
1178255981_1178255985 -2 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255985 21:31052998-31053020 CATCTGAGAGAGGCAGTGGAAGG No data
1178255981_1178255993 20 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255993 21:31053020-31053042 GATGGGGGGGCAAGAGGAAGTGG No data
1178255981_1178255988 4 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255988 21:31053004-31053026 AGAGAGGCAGTGGAAGGATGGGG No data
1178255981_1178255984 -6 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255984 21:31052994-31053016 TAAGCATCTGAGAGAGGCAGTGG No data
1178255981_1178255990 6 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255990 21:31053006-31053028 AGAGGCAGTGGAAGGATGGGGGG No data
1178255981_1178255992 14 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255992 21:31053014-31053036 TGGAAGGATGGGGGGGCAAGAGG No data
1178255981_1178255989 5 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255989 21:31053005-31053027 GAGAGGCAGTGGAAGGATGGGGG No data
1178255981_1178255991 7 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255991 21:31053007-31053029 GAGGCAGTGGAAGGATGGGGGGG No data
1178255981_1178255986 2 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255986 21:31053002-31053024 TGAGAGAGGCAGTGGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178255981 Original CRISPR TGCTTACTCATGGATCACTC CGG (reversed) Intergenic
No off target data available for this crispr