ID: 1178255985 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:31052998-31053020 |
| Sequence | CATCTGAGAGAGGCAGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1178255979_1178255985 | 28 | Left | 1178255979 | 21:31052947-31052969 | CCTGATAAATCATAATGGGCTAA | No data | ||
| Right | 1178255985 | 21:31052998-31053020 | CATCTGAGAGAGGCAGTGGAAGG | No data | ||||
| 1178255981_1178255985 | -2 | Left | 1178255981 | 21:31052977-31052999 | CCGGAGTGATCCATGAGTAAGCA | No data | ||
| Right | 1178255985 | 21:31052998-31053020 | CATCTGAGAGAGGCAGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1178255985 | Original CRISPR | CATCTGAGAGAGGCAGTGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||