ID: 1178255985

View in Genome Browser
Species Human (GRCh38)
Location 21:31052998-31053020
Sequence CATCTGAGAGAGGCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178255979_1178255985 28 Left 1178255979 21:31052947-31052969 CCTGATAAATCATAATGGGCTAA No data
Right 1178255985 21:31052998-31053020 CATCTGAGAGAGGCAGTGGAAGG No data
1178255981_1178255985 -2 Left 1178255981 21:31052977-31052999 CCGGAGTGATCCATGAGTAAGCA No data
Right 1178255985 21:31052998-31053020 CATCTGAGAGAGGCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178255985 Original CRISPR CATCTGAGAGAGGCAGTGGA AGG Intergenic
No off target data available for this crispr