ID: 1178258034

View in Genome Browser
Species Human (GRCh38)
Location 21:31073211-31073233
Sequence TGCCATGTACAGAACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178258034_1178258036 -6 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258036 21:31073228-31073250 ATGGCATCTATCTAGGATAGAGG No data
1178258034_1178258041 19 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258041 21:31073253-31073275 GGAAGCTGAAGGGAGATTCAGGG No data
1178258034_1178258038 8 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258038 21:31073242-31073264 GGATAGAGGCTGGAAGCTGAAGG No data
1178258034_1178258037 -2 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258037 21:31073232-31073254 CATCTATCTAGGATAGAGGCTGG No data
1178258034_1178258039 9 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258039 21:31073243-31073265 GATAGAGGCTGGAAGCTGAAGGG No data
1178258034_1178258042 27 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258042 21:31073261-31073283 AAGGGAGATTCAGGGAGTCCTGG No data
1178258034_1178258043 28 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258043 21:31073262-31073284 AGGGAGATTCAGGGAGTCCTGGG No data
1178258034_1178258040 18 Left 1178258034 21:31073211-31073233 CCTGCAGGGTTCTGTACATGGCA No data
Right 1178258040 21:31073252-31073274 TGGAAGCTGAAGGGAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178258034 Original CRISPR TGCCATGTACAGAACCCTGC AGG (reversed) Intergenic
No off target data available for this crispr