ID: 1178261666

View in Genome Browser
Species Human (GRCh38)
Location 21:31105705-31105727
Sequence AGATACAAACTGATATAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178261666_1178261676 30 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261676 21:31105758-31105780 GGAGAGCTCTTGGGGATAGGTGG No data
1178261666_1178261675 27 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG No data
1178261666_1178261674 22 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261674 21:31105750-31105772 TTTGTTTGGGAGAGCTCTTGGGG No data
1178261666_1178261669 -9 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261669 21:31105719-31105741 TTTGTATCTTAGGCAGATAAAGG No data
1178261666_1178261671 9 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261671 21:31105737-31105759 AAAGGAACTTCAGTTTGTTTGGG No data
1178261666_1178261670 8 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261670 21:31105736-31105758 TAAAGGAACTTCAGTTTGTTTGG No data
1178261666_1178261672 20 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261672 21:31105748-31105770 AGTTTGTTTGGGAGAGCTCTTGG No data
1178261666_1178261673 21 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261673 21:31105749-31105771 GTTTGTTTGGGAGAGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178261666 Original CRISPR AGATACAAACTGATATAGGT TGG (reversed) Intergenic