ID: 1178261667

View in Genome Browser
Species Human (GRCh38)
Location 21:31105709-31105731
Sequence CCTAAGATACAAACTGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178261667_1178261672 16 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261672 21:31105748-31105770 AGTTTGTTTGGGAGAGCTCTTGG No data
1178261667_1178261675 23 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG No data
1178261667_1178261676 26 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261676 21:31105758-31105780 GGAGAGCTCTTGGGGATAGGTGG No data
1178261667_1178261671 5 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261671 21:31105737-31105759 AAAGGAACTTCAGTTTGTTTGGG No data
1178261667_1178261674 18 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261674 21:31105750-31105772 TTTGTTTGGGAGAGCTCTTGGGG No data
1178261667_1178261673 17 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261673 21:31105749-31105771 GTTTGTTTGGGAGAGCTCTTGGG No data
1178261667_1178261670 4 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261670 21:31105736-31105758 TAAAGGAACTTCAGTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178261667 Original CRISPR CCTAAGATACAAACTGATAT AGG (reversed) Intergenic