ID: 1178261675

View in Genome Browser
Species Human (GRCh38)
Location 21:31105755-31105777
Sequence TTGGGAGAGCTCTTGGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178261667_1178261675 23 Left 1178261667 21:31105709-31105731 CCTATATCAGTTTGTATCTTAGG No data
Right 1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG No data
1178261666_1178261675 27 Left 1178261666 21:31105705-31105727 CCAACCTATATCAGTTTGTATCT No data
Right 1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178261675 Original CRISPR TTGGGAGAGCTCTTGGGGAT AGG Intergenic