ID: 1178262459

View in Genome Browser
Species Human (GRCh38)
Location 21:31112752-31112774
Sequence GCTCCTAATCAGTTTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178262459_1178262464 22 Left 1178262459 21:31112752-31112774 CCTTCTTCAAACTGATTAGGAGC No data
Right 1178262464 21:31112797-31112819 TTACCGAAGGATTAGCTTCCTGG No data
1178262459_1178262467 29 Left 1178262459 21:31112752-31112774 CCTTCTTCAAACTGATTAGGAGC No data
Right 1178262467 21:31112804-31112826 AGGATTAGCTTCCTGGTCGGTGG No data
1178262459_1178262466 26 Left 1178262459 21:31112752-31112774 CCTTCTTCAAACTGATTAGGAGC No data
Right 1178262466 21:31112801-31112823 CGAAGGATTAGCTTCCTGGTCGG No data
1178262459_1178262460 -2 Left 1178262459 21:31112752-31112774 CCTTCTTCAAACTGATTAGGAGC No data
Right 1178262460 21:31112773-31112795 GCAAATAATTAGAAACCACCTGG No data
1178262459_1178262461 9 Left 1178262459 21:31112752-31112774 CCTTCTTCAAACTGATTAGGAGC No data
Right 1178262461 21:31112784-31112806 GAAACCACCTGGCTTACCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178262459 Original CRISPR GCTCCTAATCAGTTTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr