ID: 1178263748

View in Genome Browser
Species Human (GRCh38)
Location 21:31123713-31123735
Sequence GAGGCAGCCCAGAATTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178263748 Original CRISPR GAGGCAGCCCAGAATTTTGC AGG (reversed) Intronic
902976454 1:20092169-20092191 GAGGCAGGGCAGTGTTTTGCTGG + Intergenic
907647073 1:56254828-56254850 GAGGCAGCTCAGAACGTTCCTGG - Intergenic
907702267 1:56800810-56800832 AAGGCAGCCCAGAGTCTTGATGG + Intronic
908521593 1:64948842-64948864 GTGGCAGCCCAGAATGTTAATGG + Intronic
909478603 1:76110495-76110517 GTGGCAAGCCAGAACTTTGCAGG - Intronic
911076384 1:93879337-93879359 AAGGCAAGCCAGATTTTTGCTGG + Intronic
919139730 1:193555962-193555984 GAGGAAGCCAAGAATCCTGCTGG + Intergenic
919148121 1:193660665-193660687 CATGCAGCCCAGATTATTGCTGG - Intergenic
919747605 1:201018209-201018231 GGGGCAGCCAAGTCTTTTGCTGG - Intronic
920261872 1:204693878-204693900 GAGGCTACCCAGCATTTTGGGGG - Intergenic
923101255 1:230819592-230819614 CACGCAGCCCAGAGTTTTGTTGG + Intergenic
923993949 1:239470521-239470543 GAAGCAACCCAGAATTGTGGAGG + Intronic
1063571162 10:7215646-7215668 GAGGCAGCACAGAACCCTGCAGG + Intronic
1063725764 10:8635761-8635783 CAGGCAGCCCAGATTTATGAAGG - Intergenic
1070930642 10:80258143-80258165 GTGCCAGCTCTGAATTTTGCAGG - Intergenic
1073293032 10:102422686-102422708 GAGGGAGACCGGGATTTTGCCGG + Intronic
1073751030 10:106527496-106527518 GAGGCAAGCCAGAATCTTGAAGG + Intergenic
1076360789 10:129887536-129887558 GAGGCAGCCCAGAATGACGTTGG + Intronic
1080428786 11:32179585-32179607 GAGGCAGGCCAGAGTTGTGGGGG - Intergenic
1081832441 11:46124940-46124962 GTGGCATCCCAGTATTTTGATGG + Intergenic
1082810046 11:57474231-57474253 GAGGCAGCCGAGAAGGTTGAGGG + Intronic
1083343135 11:61971869-61971891 GAGGCAGCAGAGAGTTTGGCTGG + Intergenic
1093284926 12:17247344-17247366 TAGGCAGAACAGAATTTTTCTGG - Intergenic
1098308660 12:69126146-69126168 ATGGAAGCACAGAATTTTGCAGG + Intergenic
1098509618 12:71296446-71296468 GATCCAGCACTGAATTTTGCAGG - Intronic
1101971245 12:109314322-109314344 AAGGTAGCTCAGAATTTTCCAGG - Intergenic
1103014996 12:117487430-117487452 GAGGCAGCCCAGAATGAGTCAGG + Intronic
1104400501 12:128472165-128472187 TATGTAGCCCAGAAGTTTGCAGG - Intronic
1105841039 13:24253870-24253892 GAGGCAGACGAGGATGTTGCAGG + Intronic
1107533138 13:41303567-41303589 GAGAAAACCCAGAATTCTGCAGG + Intergenic
1107710413 13:43145406-43145428 GAGGCAGCTGAGAATGTTCCTGG + Intergenic
1109967112 13:69715001-69715023 TATGCTGCCCAGAATTTTTCTGG - Intronic
1113604859 13:111597912-111597934 GAGCCAGCCCAGAATGTGGAGGG - Intronic
1119086183 14:71741336-71741358 GATGCAGCCCAAAAATGTGCTGG - Intergenic
1122219734 14:100229715-100229737 GAGGCTGCTCAGAATAGTGCAGG + Intergenic
1122425375 14:101602476-101602498 GAGCCACCCCAGACTCTTGCTGG - Intergenic
1122546064 14:102523615-102523637 GAGGCAGCCCTGAACCTTCCCGG + Intergenic
1123921817 15:25075549-25075571 GAGGCAGGCATGAATTTTGAAGG - Intergenic
1125097089 15:35867270-35867292 GAGTCAGCCCAGATTTTCTCAGG + Intergenic
1125838304 15:42773666-42773688 GAGGCACACCAGAATGCTGCTGG + Intronic
1129274208 15:74434522-74434544 GAGGCAGCCCAGAAGGCTGCTGG - Intergenic
1129773594 15:78218447-78218469 GAGGCAGCTCTGAATGTGGCAGG + Intronic
1130055701 15:80523465-80523487 GAGGAAGCCCATAATACTGCAGG + Intronic
1131840181 15:96428796-96428818 GAAGCAGCCCTGTAATTTGCAGG + Intergenic
1134234419 16:12454312-12454334 GAGGCAGTCCAGAATTGGGATGG - Intronic
1135560347 16:23471515-23471537 GAGCCAGCCCTGATTTTTGAAGG - Intronic
1140017816 16:71205473-71205495 GAGCCACCCCAGCATTTTGCAGG + Intronic
1140945905 16:79768278-79768300 TAGGCAGCCCTGAATTTTAAAGG - Intergenic
1143017100 17:3896693-3896715 CAGGGAGCCCAGGATTTGGCTGG + Exonic
1143774092 17:9186444-9186466 GAGGGAGCCCAGAAGTTGGCTGG - Intronic
1144485190 17:15658774-15658796 AAACCAGCCCAGAATTTTACTGG + Intronic
1144768057 17:17743683-17743705 GGAGCAGCCCAGGATTTGGCTGG + Intronic
1145897822 17:28470744-28470766 GAGGCAACCCAGCATTGTGCAGG - Intronic
1147310731 17:39594888-39594910 GAGGCAGCCAAGAGGTTTTCTGG + Intergenic
1152095311 17:78268845-78268867 GAGGGAGCCCAGGATTCTGGCGG - Intergenic
1156398798 18:36722482-36722504 GAGGGAGCCCAGAATGTATCTGG + Intronic
1157409062 18:47448741-47448763 CAGGCAGCCCACAGGTTTGCAGG + Intergenic
1159558373 18:69968338-69968360 AAAGCAGCTCATAATTTTGCAGG + Intergenic
1160002531 18:75040111-75040133 AATGCAGCACAGAATTTTGGGGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1167469743 19:49668998-49669020 GAGGCAGAAGAGAATTTGGCTGG - Intronic
1167770325 19:51510697-51510719 GAGGGAACCCACAAGTTTGCAGG - Intergenic
925316849 2:2933141-2933163 GAGCCAGCCCTGGAATTTGCTGG - Intergenic
931769752 2:65487319-65487341 GAGGTAGCCCAGAATCTTCAAGG + Intergenic
935831416 2:107004830-107004852 GAGGCAGCCCTGAATTATGCCGG + Intergenic
938917793 2:135960847-135960869 CAGACAGCCCAGACTTTTACAGG + Intronic
940774951 2:157875913-157875935 GAGGGAGCCCGGAACTCTGCGGG + Intergenic
946039658 2:216772951-216772973 GAGGCAGCCCATAATCCTGGAGG + Intergenic
948829121 2:240589132-240589154 AAGGCACCCCAGAATTAAGCTGG + Intronic
1168752611 20:293829-293851 GAAGCAGCTCGGAATTTGGCAGG - Intergenic
1171419731 20:25009946-25009968 GAGGCAGCTGAGAGTTCTGCTGG + Intronic
1171842702 20:30234668-30234690 GTTGCAGCCTAAAATTTTGCTGG - Intergenic
1172045874 20:32079827-32079849 GAAGGAGCCCAGCATGTTGCCGG - Exonic
1172228436 20:33320883-33320905 GCTGCAGTTCAGAATTTTGCAGG - Intergenic
1172891870 20:38271398-38271420 GAGGCAGCCAAGAACCTTGCTGG + Intronic
1173956266 20:47035328-47035350 GAGGGAGCCCTGACCTTTGCTGG - Intronic
1174296291 20:49547583-49547605 GAGGCAGCCCTGATTTTAGTAGG - Intronic
1175373627 20:58509776-58509798 GAGGCATCCAAGAATCTAGCTGG - Intronic
1175608493 20:60330834-60330856 GAAGCAGAACTGAATTTTGCTGG + Intergenic
1175901953 20:62363489-62363511 GATGCAGGCCAGGATTCTGCTGG - Intronic
1178263748 21:31123713-31123735 GAGGCAGCCCAGAATTTTGCAGG - Intronic
1181852952 22:25763006-25763028 GGGGCAGCCAGGAATTATGCGGG - Intronic
951787469 3:26438090-26438112 AAGGCAGCCCAGAATTAAGTGGG + Intergenic
951910807 3:27748609-27748631 GTGGTAGGCCAGAATTTTCCTGG + Intergenic
956854161 3:73259529-73259551 GAGGCAGTGCAGATTTTTGGAGG - Intergenic
957152368 3:76502161-76502183 GAGACAGCCCAGAATCATGAAGG + Intronic
962224981 3:133598328-133598350 GAGGCACACCAGGAGTTTGCCGG - Intronic
962364413 3:134768320-134768342 CAGCCAGCCCCGAATTTTTCAGG + Intronic
964201305 3:154121752-154121774 GCGGCAGCCCAGATTTCTGCCGG + Intronic
966369626 3:179235095-179235117 GTGGGAGCCCAGAATTTCCCTGG - Exonic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
969259077 4:6022312-6022334 GAGCCAGCCCTGAATGTTCCTGG - Intergenic
970472940 4:16394543-16394565 GAGGCATCCCAGGTTTTTCCAGG + Intergenic
970822867 4:20239351-20239373 GAGGCAGAAAAGAATTTTGGTGG + Intergenic
971929690 4:33064408-33064430 GAGGCTGCTTAGAATTTTGCTGG - Intergenic
972958481 4:44421826-44421848 GAGTAAGCCCAGAATTTTTATGG + Intronic
975903159 4:79177326-79177348 GAGGAAGCCCAGAAGTTAACAGG - Intergenic
979217448 4:118182461-118182483 GAGGCATCCCAGATTTTTTGTGG - Intronic
979340538 4:119517423-119517445 GAGGAAACCAAGAATTTTCCAGG - Intronic
980670762 4:136003534-136003556 GAGGCTGCCTAGCATTTTGTAGG - Intergenic
983841851 4:172467009-172467031 GAGGATGCCCAGAATTTAACTGG + Intronic
985289819 4:188376151-188376173 GAGGCAGCCCAGTAGTGTGCAGG + Intergenic
986297370 5:6449975-6449997 GAGGCAGCCCAGAAGAAGGCAGG - Intronic
999105112 5:149063653-149063675 GATGAAGCCCAGCATTTTACAGG + Intergenic
1000986957 5:167871309-167871331 GAGGAAGCCCTGGATTTGGCAGG - Intronic
1002613997 5:180439118-180439140 GAGACAGCCCAGAATAATGGAGG - Intergenic
1004987969 6:21104337-21104359 GAAGGAGCCAGGAATTTTGCAGG + Intronic
1007303918 6:40889951-40889973 TTGGGAGCCCAGAACTTTGCAGG - Intergenic
1007953281 6:45892430-45892452 GAGGAAGCCCAGCATTTGACTGG + Intergenic
1016847043 6:148578872-148578894 GAGCCACCCCAAATTTTTGCAGG + Intergenic
1018409883 6:163533707-163533729 GAGTCAGCACAGCATTTTACAGG - Intronic
1020092297 7:5348567-5348589 GAGACAGCCCGGATTTCTGCTGG + Intronic
1022806188 7:33824804-33824826 GAGGCAGCCCATACTCTTTCGGG - Intergenic
1025005641 7:55352570-55352592 AAGTCAGCCCAGAATTTAGGCGG - Intergenic
1026582396 7:71629273-71629295 GAGCCAGCCCACAATCCTGCGGG + Intronic
1028251432 7:88543561-88543583 GGGGCATTACAGAATTTTGCAGG - Intergenic
1030417685 7:109265919-109265941 GAGCAAGGCTAGAATTTTGCAGG - Intergenic
1035743982 8:1948212-1948234 GAGCCAGCCCAGGATGTTGGAGG - Intronic
1037349850 8:17941005-17941027 GAGGCAGGTAAGAATTATGCAGG - Intronic
1037715546 8:21394472-21394494 GAGGCAGCTCATCATATTGCGGG + Intergenic
1038096693 8:24320020-24320042 GAATCAGACCAGAATATTGCTGG + Intronic
1039062850 8:33585555-33585577 TAGGCAGCTCAGAATTATGCTGG - Intergenic
1047700611 8:127445784-127445806 GAGGCTGCCCAGAGTCTTGTGGG + Intergenic
1049502768 8:142976411-142976433 GAGGAAGACATGAATTTTGCAGG + Intergenic
1050615424 9:7396817-7396839 AAGGCAGCCCTGAGTTCTGCAGG - Intergenic
1054165280 9:61719998-61720020 GTTGCAGCCTAAAATTTTGCTGG + Intergenic
1055240849 9:74183856-74183878 AAGGGAGTCCAGAATTTGGCAGG + Intergenic
1056495224 9:87149071-87149093 GAGCCTGCCCAGAATGTTGGGGG - Intronic
1057064470 9:92035870-92035892 GAGCCAGTCCAGATGTTTGCAGG - Intronic
1057706029 9:97395831-97395853 GTGGCAGCCCAGATTTCTGCGGG + Intergenic
1059078110 9:111216768-111216790 GAGTCATCCAGGAATTTTGCTGG - Intergenic
1060680422 9:125558097-125558119 GAGGCAGGCCAGGATTTGGGAGG - Intronic
1062541739 9:137044599-137044621 CAGGCAGCCCAGACGTTGGCGGG - Intronic
1186380667 X:9055246-9055268 GAGGCAGCGCAGCATTCTGCAGG + Intronic
1190266212 X:48828643-48828665 GAGGGAGGGCAGGATTTTGCCGG - Intergenic
1193141954 X:78036782-78036804 GAGGCAGGAGAGAATCTTGCGGG + Intronic
1195673024 X:107484834-107484856 GAGGCAGCAGAGACTATTGCTGG - Intergenic
1198850542 X:140961576-140961598 GAGGCAGGTCAGAATTCTTCGGG - Intergenic
1199597042 X:149514329-149514351 GTGACACCCCAGAATTTTGTGGG + Intronic
1200778871 Y:7196492-7196514 GAGGATGCACAGAATTTTGTGGG - Intergenic