ID: 1178264649

View in Genome Browser
Species Human (GRCh38)
Location 21:31131887-31131909
Sequence TTCCTAGCTGTGGCTTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178264649_1178264653 -1 Left 1178264649 21:31131887-31131909 CCATATGAAGCCACAGCTAGGAA 0: 1
1: 0
2: 1
3: 19
4: 284
Right 1178264653 21:31131909-31131931 AGTAGGAGAAAGCAGGATCTTGG 0: 1
1: 0
2: 1
3: 33
4: 322
1178264649_1178264652 -8 Left 1178264649 21:31131887-31131909 CCATATGAAGCCACAGCTAGGAA 0: 1
1: 0
2: 1
3: 19
4: 284
Right 1178264652 21:31131902-31131924 GCTAGGAAGTAGGAGAAAGCAGG 0: 1
1: 1
2: 3
3: 35
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178264649 Original CRISPR TTCCTAGCTGTGGCTTCATA TGG (reversed) Intronic
901942558 1:12674681-12674703 TTTCCAGCTGTAGCATCATATGG - Intergenic
902880374 1:19368309-19368331 TTCAGTGGTGTGGCTTCATACGG - Intronic
905011897 1:34753061-34753083 TTCCCAGCTGTGGCTGAACAAGG + Intronic
905514601 1:38552992-38553014 TTTCTTGCTGTATCTTCATATGG + Intergenic
906697853 1:47836800-47836822 CTTCTAGCTGTGTCCTCATATGG - Intronic
907626909 1:56039561-56039583 CTCCTTGCTGTGTCTTCACAAGG + Intergenic
908113077 1:60916236-60916258 CTCCTTGCTGTGTCTTCACATGG + Intronic
908954321 1:69603088-69603110 TTTCTAGCTCTGTCTTCACATGG + Intronic
911840513 1:102675849-102675871 GCCCTAGCTGTTGCTTCAGAGGG - Intergenic
912422041 1:109548980-109549002 TTCCTAGCTGAGGCCCCAGAGGG + Intronic
912859031 1:113196585-113196607 CTTCTGGCTGTGTCTTCATATGG - Intergenic
913109945 1:115648726-115648748 TTCCTAGCTGTGACATCAGGGGG - Intronic
914450197 1:147784822-147784844 TTCCAAGCTTTGGCTTGGTATGG - Intergenic
915204224 1:154257489-154257511 TTTATAGCTCTGGCTTCAGATGG + Intronic
916198214 1:162244948-162244970 TTCCTAACTATGGCTATATAGGG + Intronic
918308588 1:183269204-183269226 GTACTAGCTGTGGCCTCATTGGG - Intronic
919066036 1:192693701-192693723 GCCCTAGCTGTTGCTTCAGAGGG - Intergenic
919252651 1:195078102-195078124 TGACTAGCTATGGGTTCATAAGG - Intergenic
920562923 1:206951949-206951971 TTCCAAGTAGTGGCTTCACAAGG - Intergenic
920744349 1:208612380-208612402 CTTCTAGCTGTGTCTTCATGTGG + Intergenic
920917732 1:210271649-210271671 TTCCCAGCTGAGGCTGGATAAGG + Intergenic
920918365 1:210276948-210276970 CTTCTTGCTGTGTCTTCATATGG - Intergenic
922537284 1:226390570-226390592 TGCCTAGCTGTGGCTTCTCCGGG + Exonic
924850990 1:247830316-247830338 TTCCTAGCTCTGGATGCAGAAGG - Intergenic
1063802281 10:9594050-9594072 TTTCTAGCTGTATCTTCACAAGG + Intergenic
1066174572 10:32890643-32890665 TTCCTTGCTGTGTCCTCAGATGG + Intergenic
1067301662 10:45016298-45016320 TTGCCAGCTTTGGCTTCATCTGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068680275 10:59811698-59811720 TTCCTATCTGTGGGTTCCTCAGG - Intronic
1069656367 10:70092170-70092192 TTTCTAGCTGTGTCCTCACATGG - Intronic
1069681348 10:70287852-70287874 CTGCTCGCTGTGGCCTCATATGG - Intergenic
1069846871 10:71378225-71378247 TCCCTAGCTATGCATTCATATGG - Intergenic
1069899525 10:71699427-71699449 TTCCCACATGTGGCTTCATTTGG + Intronic
1070692402 10:78536891-78536913 TTCCCAGCTGTGTTTTCAAATGG + Intergenic
1072022031 10:91411209-91411231 TTCCCAGCTGTATCTTCGTAAGG + Intronic
1072295527 10:94005880-94005902 TCCCTGGCCTTGGCTTCATAGGG - Intronic
1073033793 10:100548942-100548964 CTCCTAGCTGTGGCTTCTCTAGG + Exonic
1073141082 10:101248228-101248250 CTTCTAGCTGTGTCTTCACATGG + Intergenic
1075651051 10:124128528-124128550 TTCCTTGCTGTGGGTACAGAGGG + Intergenic
1077408496 11:2393012-2393034 TTCCTGGCAGAGGCTTCATCTGG + Intronic
1077805451 11:5587538-5587560 CTTCTAGCTGTGTCTTCACATGG + Intronic
1080251042 11:30234002-30234024 TTCCTAGGTCTGATTTCATAAGG + Exonic
1081062673 11:38500025-38500047 CTCCTAGCTGTGTCCTCAAATGG - Intergenic
1081402265 11:42656996-42657018 TTCACACCTGTGGCTTCATAGGG - Intergenic
1083357446 11:62077395-62077417 TTTCTAGCTGTGTCTTCACATGG + Intergenic
1083585544 11:63856107-63856129 TTACTTGCTTTGACTTCATAAGG + Intronic
1084857402 11:71997905-71997927 TCCCCAGCTGTGGCTTCCCATGG + Intergenic
1085250240 11:75138674-75138696 TTTCTAGCTGTGTCCTCACATGG + Intronic
1085706603 11:78791992-78792014 TTCCTAGCTGTGGGTACTTGGGG + Intronic
1086202664 11:84222600-84222622 TTCCAAGCTGTGGTGACATAAGG - Intronic
1086468199 11:87076615-87076637 TTCCCAGCTGTGGCTGGCTATGG - Intronic
1086472836 11:87134207-87134229 TTTCTCCCTGTGCCTTCATATGG + Intronic
1087318368 11:96631274-96631296 TCCTTAGCTGTGGCTTCAAAAGG + Intergenic
1087437352 11:98138336-98138358 TTCCTAGATATGACTTCATGGGG + Intergenic
1089188109 11:116634821-116634843 TTTCTTGCTGTGACTTCACATGG + Intergenic
1092617359 12:10227363-10227385 TTTCTAGCTGTGGTTTCTTTTGG + Intergenic
1095788924 12:46143230-46143252 TTCCCAGCTGTGGCTGCTTTGGG - Intergenic
1095884725 12:47177061-47177083 TTCACAGCTGGTGCTTCATATGG - Intronic
1098788849 12:74794473-74794495 CTCCTATCTGTGTCTTCATGGGG + Intergenic
1100052184 12:90461873-90461895 TTTTGAGCTGTGGCTTCATCTGG + Intergenic
1100714706 12:97293659-97293681 TTCTTAGCTGTGCCTTCCAAGGG + Intergenic
1102200790 12:111056364-111056386 ATGATAGCTGTGGCTTCATCTGG + Intronic
1104110013 12:125696005-125696027 TTTCTAGCTGTATCTTCACATGG + Intergenic
1104401140 12:128477358-128477380 TTCCAAGCTTTGGCCTCATGCGG - Intronic
1104713368 12:131000828-131000850 TTCCTAGAAGTGGCATAATATGG + Intronic
1105932425 13:25065458-25065480 CTTCTAGCTGTGTCTTCACATGG + Intergenic
1106692084 13:32129043-32129065 TTTCTCCCTGTGTCTTCATATGG + Intronic
1107068402 13:36242874-36242896 TTCATAGCTGCTGCTACATAAGG + Intronic
1108038448 13:46316497-46316519 TTTCTAGCTGTGTCCTCACATGG + Intergenic
1109014420 13:56991502-56991524 CTTCTAGCTGTGTCTTCACAGGG + Intergenic
1109031355 13:57193820-57193842 TTCCTATCTATGTCTTCACATGG - Intergenic
1109732657 13:66436310-66436332 TTTCTTGCTGTGTCTTCACAAGG - Intronic
1110096281 13:71526272-71526294 TTACCAGCTGTGCCTTTATATGG + Intronic
1110161938 13:72388924-72388946 CTTCTAGCTGTGTCTTCACATGG - Intergenic
1111178191 13:84625961-84625983 TTCTTTGCTGTGTCTTCACATGG + Intergenic
1112039681 13:95534299-95534321 GTCCTGGCAGTAGCTTCATATGG - Intronic
1112195264 13:97219554-97219576 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1112220390 13:97483433-97483455 TTTCTCACTGTGTCTTCATATGG - Intergenic
1112283443 13:98082841-98082863 CTTCTAGCTGTGTCCTCATATGG - Intergenic
1112414584 13:99193674-99193696 TTTCCAGCTGTGCCTTCACATGG + Intergenic
1113520499 13:110937194-110937216 TGCCTAGCTGAGGCTTCTCAGGG - Intergenic
1114314751 14:21499396-21499418 TTCAAAGGTGTGGTTTCATAAGG - Intronic
1114544455 14:23488336-23488358 TTCCTAGCTAGGACTTCAGATGG + Intronic
1115341082 14:32293543-32293565 TTTCTAGCTGTGTCCTCATGTGG + Intergenic
1115808579 14:37079982-37080004 CTTCTAGCTGGGTCTTCATAGGG - Intronic
1116198428 14:41758224-41758246 TTTCCAGATGTGGCTTGATAAGG + Intronic
1117144923 14:52827752-52827774 TTTCTAGTTGTGGCCTCATATGG - Intergenic
1117282051 14:54251145-54251167 TTCTTGGCTGTGACTTCATCAGG + Intergenic
1119348455 14:73944870-73944892 TTCCCAGGTGTGGCTCCACAAGG - Exonic
1120498906 14:85269680-85269702 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1121069921 14:91009286-91009308 TTTCTAGCTGTGTCCTCACATGG - Intronic
1122039980 14:98980291-98980313 TTTCTAGCTGTATCTTCACAGGG - Intergenic
1125962700 15:43845442-43845464 CTTCTAGCTGTGTCCTCATATGG - Intronic
1126503158 15:49370014-49370036 TTCCTTGTTGTGTCCTCATATGG - Intronic
1131093469 15:89641240-89641262 TTCCTGGCTGTGTCTTGACACGG - Intronic
1131423918 15:92329923-92329945 CTCCTAGCTGTATCCTCATATGG - Intergenic
1131953078 15:97702742-97702764 TTCCTAGGAGTGACTGCATAAGG - Intergenic
1133466716 16:6034490-6034512 TTCCTGGCTGCATCTTCATATGG + Intronic
1133851547 16:9509077-9509099 TTCCCAGCAGTGGCATCATTGGG - Intergenic
1135983470 16:27166792-27166814 TTCCTTGAAGGGGCTTCATAGGG - Intergenic
1136229158 16:28876885-28876907 TTCCTAAGTGTGGCTTCTTAAGG - Intergenic
1138694346 16:58797853-58797875 CTTCTAGCTGTGTCCTCATATGG + Intergenic
1138903690 16:61304626-61304648 CTCCTAGCTGTGGGAACATATGG - Intergenic
1139011427 16:62639337-62639359 TTCCTGTTTGTGGCTTCAAAGGG - Intergenic
1139025504 16:62812674-62812696 CTTCTTCCTGTGGCTTCATATGG - Intergenic
1139407264 16:66729033-66729055 TTCTTACCTGTTGCTTCATTAGG + Exonic
1140185775 16:72769710-72769732 TGCCTAGATGTGGGATCATATGG - Intergenic
1140231908 16:73124313-73124335 CTCCTTGCTGTGCCTTCATGTGG + Intergenic
1140767478 16:78173917-78173939 TTTCTTGCTGTGTCCTCATATGG + Intronic
1140916628 16:79499634-79499656 CTTCTACCTGTGTCTTCATATGG - Intergenic
1141996429 16:87639041-87639063 TTCCTGGCTGTGTGTTCCTAGGG + Intronic
1142211503 16:88810755-88810777 TTCTTAGCTGTGTGTTCCTAGGG + Intronic
1142526172 17:543213-543235 TTCTTAGCTGTGGCTTTCCATGG + Intronic
1146839991 17:36144867-36144889 TTTCTTGCTGTGTCTTCATGTGG + Intergenic
1149454176 17:56774231-56774253 TTCTTTGCTGTGTTTTCATAAGG - Intergenic
1149809664 17:59655980-59656002 ATTCCAGCTGTGGCTTCATGAGG - Exonic
1150201842 17:63365279-63365301 CTCACAGCTGTGGCTTCTTATGG - Intronic
1150832256 17:68534171-68534193 TTCAGAGCTGTGACTTCATCTGG + Intronic
1150999944 17:70363476-70363498 TTACTAGCTGTGAGTTCTTAGGG + Intergenic
1151393887 17:73806995-73807017 CTTCTAGCTGTGTCTTCATATGG + Intergenic
1153585309 18:6614777-6614799 TTTCTGGCTGTGTCTTCACATGG + Intergenic
1153943246 18:9995096-9995118 TTCCTGTCTCTGGCTTCAGATGG - Intergenic
1154393821 18:13968953-13968975 TTCCTCACTGTGGCATCACATGG + Intergenic
1155561169 18:27078762-27078784 TTCCTAGCTGAGGCTAAAGAAGG - Intronic
1157416338 18:47506446-47506468 CTTCTAGCTGTGTCCTCATATGG - Intergenic
1157647036 18:49285029-49285051 CTTCTAGCTGTGTCTTCACATGG - Intronic
1158211116 18:55051471-55051493 TTTCTTGCTGTGTCCTCATATGG + Intergenic
1158640362 18:59198218-59198240 TCCCTACCTGTGGCCTCATTTGG - Intergenic
1160053802 18:75461108-75461130 TTCCTCACTGTGTCTTCACATGG + Intergenic
1164781969 19:30900040-30900062 CTCCTGGCTGTGTCCTCATATGG - Intergenic
1166919056 19:46216075-46216097 TTCCTCCCTGTGTCTTCACATGG - Intergenic
1167106990 19:47436181-47436203 TTCCCAGCTGAGTCTTCAAATGG - Intronic
925036186 2:688150-688172 CTCCTTGCTGTGCCATCATATGG + Intergenic
925294559 2:2768608-2768630 TTCCCAGGTGTGGCTGCACATGG + Intergenic
925489455 2:4375683-4375705 TCTCAAGCTGTGGCTTCAGAGGG - Intergenic
926564262 2:14452597-14452619 TCCCCAGCTGTGGCTACAGAGGG - Intergenic
928694019 2:33830428-33830450 TTTCTAGCTGTGTCCTCACATGG - Intergenic
929227438 2:39525254-39525276 TTCCTTGCTGTGACTTCACAAGG + Intergenic
929568254 2:43003826-43003848 CTTCTAGCTGTGTCCTCATATGG - Intergenic
929762550 2:44817995-44818017 ATCCTAGCAGTGGCCTCATGAGG - Intergenic
929941794 2:46339820-46339842 TTCATAGCTGTGTCTCCACATGG + Intronic
931047069 2:58366428-58366450 CTTCTTGCTGTGTCTTCATATGG - Intergenic
931647744 2:64440490-64440512 TTCCTGCCTCTGCCTTCATAAGG + Intergenic
932941328 2:76170162-76170184 TTTCTAGCTGTGTCCTCACATGG - Intergenic
934512568 2:94957824-94957846 TTCCTAGATGTGCATACATAGGG + Intergenic
935700709 2:105809453-105809475 CTTCTTGCTGTGTCTTCATAAGG + Intronic
937647638 2:124283806-124283828 CTCCTAGCTGTGTCTTCACATGG + Intronic
938800989 2:134763182-134763204 TTCCTAGCTGTGTGTCCTTAGGG - Intergenic
940196858 2:151104417-151104439 CTTCTAGCTGTGTGTTCATATGG - Intergenic
941449675 2:165644980-165645002 CTCCTTGCTGTGTCCTCATATGG + Intronic
941711082 2:168714099-168714121 CTTCTAGCTGTGTCTTCGTATGG + Intronic
941711168 2:168714713-168714735 CTTCTAGCTGTGTCATCATATGG - Intronic
942594840 2:177583158-177583180 TTTCTTGCTGTGTCTTCACATGG + Intergenic
942747503 2:179251779-179251801 CTTCTTGCTGTGTCTTCATATGG - Intronic
945126454 2:206516546-206516568 CTTCTTGCTGTGTCTTCATATGG + Intronic
946239734 2:218346180-218346202 TTCCTCGCTGTGGCTCCAAAGGG - Exonic
946918624 2:224553716-224553738 CTCCTTGCTGTGTCTTCACAGGG - Intronic
946961078 2:224986657-224986679 CTTCTCACTGTGGCTTCATATGG - Intronic
948167132 2:235871632-235871654 TTCTTACCTGTTGCTGCATAAGG + Intronic
948235058 2:236381152-236381174 CTCCTAGCTGTGTCTTCATATGG - Intronic
948307859 2:236963099-236963121 CTTCTTCCTGTGGCTTCATATGG + Intergenic
948439963 2:237980408-237980430 TTCCTGGCTGTGTCTTCACGTGG + Intronic
1168836952 20:883902-883924 TTCCTACCTGTAGCTTCCTTAGG + Intronic
1169416670 20:5423157-5423179 CTTCTTGCTGTGTCTTCATATGG - Intergenic
1171765110 20:29259399-29259421 TTTCCAGCATTGGCTTCATAGGG - Intergenic
1171773463 20:29345326-29345348 CTCCTAGCTGTGTCCTCAAATGG + Intergenic
1171902876 20:30873150-30873172 CTCCTAGCTGTGTCCTCAAATGG - Intergenic
1172911957 20:38416143-38416165 TGCCTTGCTGTGTCCTCATATGG - Intergenic
1174233034 20:49062383-49062405 TTTCTACCTTTGGCTTCATAGGG - Intronic
1175314892 20:58040300-58040322 TTCCTTGATGTGGCTTCCAAAGG + Intergenic
1177361710 21:20081416-20081438 TTTCTCGCTGTGTCTTCACATGG + Intergenic
1177794402 21:25758439-25758461 TTCCTAGCTGTGACTTTATGGGG - Intronic
1177923551 21:27184926-27184948 TTTCTAGCTGTGTCCTCAAATGG + Intergenic
1178223352 21:30686073-30686095 TTTCTTGCTGTGTCTTCATGTGG + Intergenic
1178264649 21:31131887-31131909 TTCCTAGCTGTGGCTTCATATGG - Intronic
1179815327 21:43902546-43902568 TTCCTGGTTGTGCCCTCATATGG + Intronic
1180318950 22:11303454-11303476 CTCCTAGCTGTGTCCTCACATGG + Intergenic
1180336266 22:11579120-11579142 CTCCTAGCTGTGTCCTCACATGG - Intergenic
1181135198 22:20760686-20760708 ATCTTAGCTTTGTCTTCATAGGG + Intronic
1181887437 22:26032378-26032400 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1182301610 22:29340248-29340270 TTCCCAGCTGGCGCTGCATAAGG + Intronic
1185191125 22:49437078-49437100 CTCCTCGCTGTGGCTGCAAACGG - Intronic
951668040 3:25148817-25148839 ATCCAAGCTGTGGCTTTAAAAGG - Intergenic
951772076 3:26269650-26269672 TTCCCAGCTGTGGAACCATAGGG - Intergenic
953453512 3:43023527-43023549 TTGCTAACTGTGGCTTCCTCTGG + Intronic
953550758 3:43900781-43900803 CTTCTAGCTGTAGCCTCATATGG - Intergenic
955197878 3:56822253-56822275 TTCCTAGCTGTGCGATCTTAAGG - Intronic
955520250 3:59768661-59768683 TGCCTAGCTTTGGTTTTATAAGG - Intronic
956054899 3:65288500-65288522 TTATGAGCTGTGGCTTCTTATGG - Intergenic
957178735 3:76848674-76848696 CTCCTTGCTGTGTCTTCACATGG + Intronic
957511470 3:81194066-81194088 TAGCTAGCTGTGTCTTCATGTGG + Intergenic
959516031 3:107268186-107268208 GTCCTAGATGTGGCTCCTTATGG - Intergenic
959770192 3:110085678-110085700 TTTCTAGCTGTGTCCTCACATGG - Intergenic
963000431 3:140676275-140676297 TTCCTAGGTGTGGGATCATATGG - Intergenic
963011684 3:140775982-140776004 GTTCCAGCTGTGGCTTCAGAGGG - Intergenic
963530968 3:146472925-146472947 TTTCTTGCTGTGGCCTCACATGG + Intronic
963927983 3:150971603-150971625 TTACTGACTGTGTCTTCATAAGG + Intronic
965708943 3:171537136-171537158 CTCCTTGCTGTGTCCTCATATGG + Intergenic
967825808 3:193876589-193876611 CTTCTAGCTGTGTCTTCACATGG + Intergenic
970076658 4:12229608-12229630 CTTCTGGCTGTGTCTTCATATGG - Intergenic
970989888 4:22200553-22200575 ATTCTACCTGTGTCTTCATATGG + Intergenic
971193388 4:24448629-24448651 CTCCCAGCTGTGGCCACATAGGG + Intergenic
973205243 4:47552459-47552481 TTCTTTACTGTGTCTTCATATGG + Intronic
975085834 4:70338540-70338562 ATGCAAGCTATGGCTTCATATGG - Intergenic
975090095 4:70391267-70391289 TTCCCTGCTGTGGCTTCATTTGG - Intergenic
977605669 4:98982920-98982942 TTTCTTGCTGTATCTTCATATGG + Intergenic
977691553 4:99917446-99917468 CTTCTAGCTGTGTCTTCACAAGG + Intronic
979714597 4:123822574-123822596 TGCCTAGCTGTGCCCTCACATGG + Intergenic
981225355 4:142287954-142287976 CTTCTAGCTGTGGCCTCACATGG + Intronic
982176331 4:152708833-152708855 TTGCTAGCTGTGGGTTTAAAAGG - Intronic
983442744 4:167808236-167808258 TTCATAGCTGTGGGTTCCTCAGG + Intergenic
983674725 4:170279483-170279505 TTCCTAGCTGCTGCTACAGATGG + Intergenic
984017689 4:174445365-174445387 TTCTAAGCTGTGGATTGATAGGG + Intergenic
984289726 4:177780656-177780678 TTTCTGGCTGTGTCTTCACATGG + Intronic
984441820 4:179780544-179780566 TTTCTGGCTGTGTCCTCATATGG + Intergenic
984559295 4:181250122-181250144 TTCCTGGGAGTGGATTCATATGG + Intergenic
985356873 4:189130304-189130326 ATACTACCTGTGGCTTTATAAGG + Intergenic
986508344 5:8475814-8475836 TTTGTAGCAGTTGCTTCATAGGG - Intergenic
986981012 5:13448044-13448066 TTTCTTGCTGTGTCCTCATATGG - Intergenic
990436607 5:55798927-55798949 TTCCTAGCTCTTGCTTCCTAAGG + Intronic
992771877 5:80056017-80056039 TTCCTACCTGTGGCTTCCTCTGG - Exonic
993399647 5:87432614-87432636 CTTCTAGCTGTGTCTTCATGTGG - Intergenic
994114271 5:96044379-96044401 CTTCTAGCTGTGTCTTTATATGG - Intergenic
994564011 5:101417133-101417155 CTTCTTGCTGTGTCTTCATATGG + Intergenic
994649488 5:102508512-102508534 TTCCTAGCTTTAGTTTCAAAAGG - Intergenic
995368342 5:111389169-111389191 TTTCTAGCTGTGTCTGCACATGG + Intronic
995808144 5:116077332-116077354 TTACTAGCTGTGGCGTAAAAGGG + Intergenic
996993977 5:129672130-129672152 CTTCTAGCTGTGTCTTCACATGG + Intronic
998051268 5:139038001-139038023 CTTCTAGCTGTGTCTTCACACGG + Intronic
998691992 5:144597303-144597325 TTCCCAGCTGAGGTTTCACAAGG + Intergenic
999153563 5:149442369-149442391 TGCCCAGCTGTGGCGTCATTGGG - Intergenic
999288630 5:150408904-150408926 TTCCTTGATGTGTCCTCATATGG - Intronic
999842089 5:155438603-155438625 TTTCTGGCTGTGTCTTCACATGG - Intergenic
1002398615 5:178977348-178977370 TCCCTTGCTGTGTCCTCATATGG - Intergenic
1003043124 6:2706735-2706757 TGCATTGCTGTGGCTTCCTATGG - Intronic
1003059898 6:2854640-2854662 TCCTGAGCTGTGGGTTCATATGG - Intergenic
1003201461 6:3965095-3965117 CTTCTAGCTGTGTCTTCACATGG - Intergenic
1004755045 6:18601790-18601812 TTCTTTGCTGGGGCTTCAAAGGG + Intergenic
1007903847 6:45439100-45439122 TTCCTAGCAGTGGGAGCATATGG + Intronic
1008615553 6:53222284-53222306 TTTCTATCTGTGTCTTCACATGG - Intergenic
1009501548 6:64420193-64420215 GTTCTGGCTGTGGCTTCAGAGGG - Intronic
1009501603 6:64420557-64420579 GCTCTAGCTGTGGCTTCAGAGGG - Intronic
1012593462 6:101011766-101011788 TTCCAAGCTGTGACTGCACAGGG - Intergenic
1013580307 6:111527510-111527532 CTTCTTGCTGTGCCTTCATATGG + Intergenic
1013957859 6:115861388-115861410 TTTCTAGCTGTGGACTCATATGG + Intergenic
1014634238 6:123825085-123825107 TTTCTAGCTGTGCCTTCATGTGG + Intronic
1015312602 6:131781974-131781996 TTCCCTGCTGTTGCTTCAAAAGG + Intergenic
1016330736 6:142949353-142949375 TTCCTTGCTGATGCTCCATATGG - Intergenic
1017535878 6:155348175-155348197 TTCCTGTCTTTGGTTTCATAGGG + Intergenic
1017595653 6:156025914-156025936 TTTCTAGCTGTGTCCTCACATGG - Intergenic
1017613292 6:156214051-156214073 TACCTTGCTGTGGCTGCTTAGGG + Intergenic
1018234902 6:161714426-161714448 CTCCTTGCTGTGTCTTCACATGG - Intronic
1019824394 7:3271793-3271815 TTACTAGCTGTGTCATCTTAAGG - Intergenic
1021097064 7:16547153-16547175 TTCCTGGCTGTGTCTTCAGCTGG - Intronic
1021412796 7:20347064-20347086 CTTCTTGCTGTGTCTTCATATGG - Intronic
1021518726 7:21517011-21517033 CTTCTAGCTGTGTCTTCACATGG + Intergenic
1022520164 7:31001014-31001036 TTTCTGGCTGTGTCTTCACATGG - Intergenic
1023823342 7:43992258-43992280 CTTCTAGCTGTGTCCTCATATGG + Intergenic
1025182156 7:56828712-56828734 TTCCTAACTGTGGCCTCCTGGGG - Intergenic
1025689773 7:63748283-63748305 TTCCTAACTGTGGCCTCCTGGGG + Intergenic
1026658359 7:72276923-72276945 TTTCTTGCTGTGTCCTCATATGG - Intronic
1028776838 7:94687277-94687299 TTTCTAGCTGTGTCCTCATATGG + Intergenic
1029751602 7:102545710-102545732 CTTCTAGCTGTGTCCTCATATGG + Intronic
1029769555 7:102644801-102644823 CTTCTAGCTGTGTCCTCATATGG + Intronic
1029887505 7:103888688-103888710 TACCAAGCTGTGGCATCATGGGG - Intronic
1031889151 7:127274178-127274200 CTTCTAGCTGTGTCTTCATGTGG + Intergenic
1032294544 7:130624074-130624096 CTTCTAGCTGTGTCTTCACATGG + Intronic
1036126721 8:6069791-6069813 CTCCCAGCTGTGTCCTCATATGG + Intergenic
1036409027 8:8481162-8481184 TTCCCAGCTGTGGCTGAACAAGG - Intergenic
1038222560 8:25624582-25624604 TTCCATGCTGTGTCATCATATGG - Intergenic
1038397692 8:27259057-27259079 TTCCTACCTGTGGCTCCCTCTGG - Intergenic
1040481125 8:47828113-47828135 TTGTTTGCTGTGGCTTCACATGG - Intronic
1040492307 8:47935764-47935786 TTCCTAGCTTTGGCAGCAAAAGG - Exonic
1042128898 8:65566915-65566937 TTCCTAGCTGCTGCTTCCTTAGG + Intergenic
1042411406 8:68470732-68470754 ATCCTAGCTGTGTCCTCACATGG + Intronic
1042439150 8:68804903-68804925 TTCTTAGCTGAGGCTCCTTATGG + Intronic
1043322430 8:79006118-79006140 TTTCTAGCTGTGTCCTCACATGG + Intergenic
1045434306 8:102145414-102145436 TTACTTGCTGTGTCTTCACATGG + Intergenic
1046724631 8:117660993-117661015 CTTCTAGCTGTGTCCTCATATGG - Intergenic
1048286161 8:133143262-133143284 TTCCTTACTGTGGCTCCTTATGG + Intergenic
1052378738 9:27746152-27746174 CTCCTAGCTGTGTCCTCACATGG - Intergenic
1053044250 9:34900844-34900866 TTCCTTGCTGTGTCCTCACATGG - Intergenic
1055578236 9:77681140-77681162 CTCCTTGCTGTGCCTTCACACGG - Intergenic
1058250171 9:102684256-102684278 TTCCTACCTGTGTCCTCACATGG + Intergenic
1058478750 9:105369360-105369382 TTTCTTGCTGTGACTTCACATGG + Intronic
1059303970 9:113339661-113339683 TTCCTTTCTGTCGCTTCAGATGG + Intronic
1059474489 9:114533598-114533620 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1059496992 9:114718235-114718257 CTTCTTGCTGTGTCTTCATATGG - Intergenic
1059516800 9:114903311-114903333 TTCCTAGGGGTGGGGTCATATGG + Exonic
1059635108 9:116162623-116162645 ATACTAGCTGTTACTTCATAGGG + Intronic
1061089338 9:128418154-128418176 CTTCTAGCTGTGTCTTCATGTGG + Intronic
1061671132 9:132188770-132188792 TTACTAGCACTGGCTTCACAGGG - Intronic
1203367175 Un_KI270442v1:269204-269226 TTCCTAGCTGTGTCCTCACATGG + Intergenic
1187329148 X:18319894-18319916 TTTCTTGCTGTGTCTTCACATGG - Intronic
1187555626 X:20348685-20348707 CTCCTCGCTGTGTCTTCACATGG + Intergenic
1192036167 X:67565158-67565180 TTCCTAGAAGTGGTTTCAGAAGG - Intronic
1192249423 X:69399046-69399068 ACCCTAGCTGTGGCTTCAGCAGG - Intergenic
1192698055 X:73438873-73438895 TTTCTAGCTGTGTCCTCACATGG + Intergenic
1195016139 X:100783300-100783322 TTTCTTGCTGTGTCTTCGTATGG - Intergenic
1195746807 X:108126841-108126863 TTCCAAGCTCTGGCTTTATCTGG - Intronic
1196327159 X:114420042-114420064 TTTCTAGCTGTGTCCTCACATGG - Intergenic
1197387240 X:125816409-125816431 TTTTTAGCTGTGTCTTCACATGG - Intergenic
1199191150 X:144972633-144972655 ATCCTTGCTGTGTCTTCACATGG - Intergenic
1199654473 X:149980974-149980996 TTCCTAGTTCTGTCTTCCTAAGG - Intergenic
1199855391 X:151755369-151755391 CTCCAAGCTGTGGCTTTGTAGGG - Intergenic