ID: 1178265506

View in Genome Browser
Species Human (GRCh38)
Location 21:31138983-31139005
Sequence AGAAATGTGCAAAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 1, 2: 3, 3: 54, 4: 550}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178265506 Original CRISPR AGAAATGTGCAAAAGATGGA AGG (reversed) Intronic
903400241 1:23039153-23039175 GGAAATGTTCTAAAGATGGTTGG - Intronic
904076950 1:27850388-27850410 AGAAATATGCAAAAGAGGCTTGG + Exonic
904748558 1:32726277-32726299 GGAATTGTCCAAAAGATAGAAGG - Intergenic
906465428 1:46074397-46074419 AGAAATCTGGAAAATATGTATGG - Intronic
906800231 1:48730577-48730599 AGAAAGGTGCAAATGGAGGAAGG + Intronic
906987447 1:50699511-50699533 AGAGATTTGCAAAAAATGGTTGG + Intronic
907423649 1:54364608-54364630 AGAAATGTGAAAAATGGGGAGGG + Intronic
908666013 1:66492016-66492038 AGCTATGTGCCAAAGACGGAAGG - Intergenic
909680040 1:78281581-78281603 AAAAATGTCCAACAGATGAAAGG + Intergenic
909681202 1:78294246-78294268 AGAAATTTGCATAAGAAGCAAGG + Intergenic
910030140 1:82710040-82710062 AGAAATGAGCAAAGGATGAAAGG - Intergenic
910057709 1:83051379-83051401 AGAAATTTGCAAAAGTAGCAAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910858184 1:91717317-91717339 AGAAATGAGCAAAAGTTAGAGGG - Intronic
911342654 1:96657444-96657466 AGAAATGAGAGAAAGAAGGAAGG + Intergenic
911995023 1:104756395-104756417 AGAAATGGGAAAACAATGGAAGG - Intergenic
912567623 1:110599635-110599657 ACAAAGCTGCAAAGGATGGAAGG + Intronic
912748428 1:112265515-112265537 AGAAATGTGCCAATGAGAGAGGG + Intergenic
915007785 1:152656029-152656051 AGAAGTATGCAAAAGAGGGGAGG + Intergenic
915396066 1:155585225-155585247 AGAAAAGTGAAAATGAGGGACGG + Intergenic
915515289 1:156409197-156409219 AGCACTGTGCAGGAGATGGAAGG + Intronic
915612476 1:157005383-157005405 TGGATAGTGCAAAAGATGGATGG + Intronic
915819390 1:159005809-159005831 AGCAATGTGGAACAGATTGAAGG + Intronic
916176513 1:162044358-162044380 AGAATAGTGCAAAGGATGGGAGG + Intergenic
916204515 1:162302288-162302310 ATAAATGTGCAATGGGTGGATGG + Intronic
916586011 1:166150970-166150992 AGAAATGTTTAGAAGTTGGATGG + Intronic
917427339 1:174928663-174928685 ACAAATTTGCAAAAGATTGCAGG - Intronic
917569592 1:176251319-176251341 TGAGATGTGCAAAATATGCAGGG - Intergenic
917681175 1:177369461-177369483 CCAAATGGGCAAAAGCTGGAAGG - Intergenic
917785582 1:178453112-178453134 TGAAAAATGCAAAAGATGGAGGG + Intronic
917941160 1:179923108-179923130 GGAAATGAGCAAAAGAGGGCTGG + Intronic
918073805 1:181153702-181153724 AGGAGTGTGCAAAAGAGGCAAGG + Intergenic
918127853 1:181600108-181600130 AGAAATCTGCAGAAGTGGGAGGG + Intronic
918859664 1:189806661-189806683 AAAAATGTTCTAGAGATGGATGG - Intergenic
919219200 1:194604115-194604137 AGAATAGTGCAAAAGATTCAAGG - Intergenic
920421778 1:205839547-205839569 AGAAAGGTGCCAAATATGGCTGG + Intronic
920584993 1:207150208-207150230 AGAAAGGTGGAAAAGGTGGTTGG - Intergenic
921516721 1:216102189-216102211 AAAAATATGAAAAAGATGGTCGG + Intronic
921744983 1:218729941-218729963 GGGAATTTACAAAAGATGGAAGG - Intergenic
922621958 1:226995327-226995349 AGAGATGTGTGAAAGATGGCTGG - Intronic
923107119 1:230863339-230863361 AGAAATGAGCAAAATATGACAGG + Intronic
923732193 1:236562790-236562812 GGAAATGTGCAAGATATGAAGGG - Intronic
924414814 1:243849277-243849299 AGAAATGTGCGGAAGATGCTGGG - Intronic
1062760578 10:13626-13648 AGCTATGCGCACAAGATGGATGG - Intergenic
1063268686 10:4483036-4483058 AGACATGTATAAAAGATGCAAGG + Intergenic
1063919700 10:10920689-10920711 AGAAATGGAGAAAAGAAGGAAGG + Intergenic
1064093744 10:12407354-12407376 AGAAATGTGAAAAGGAAGGCTGG - Intronic
1064493606 10:15885348-15885370 AGAGATTTGAGAAAGATGGAGGG - Intergenic
1064894358 10:20217228-20217250 AGGAAAGAGAAAAAGATGGATGG - Intronic
1065203542 10:23336965-23336987 AGAAATGCTCAAAAGATGATGGG + Intronic
1065367565 10:24951258-24951280 AGATATGTGCAATAGGAGGAGGG - Intronic
1065787011 10:29225546-29225568 AGAAATATGCAAGAGAGAGACGG - Intergenic
1066551620 10:36564756-36564778 AGAAATCTGAACAAGACGGATGG + Intergenic
1066681211 10:37938183-37938205 AGAAAATTACAAAAGCTGGAAGG + Intergenic
1067580718 10:47443878-47443900 GGAAAAGTACAAAAGTTGGAAGG + Intergenic
1067740244 10:48890062-48890084 AAACATGTGCAGAAGATGCACGG - Intronic
1068227856 10:54129945-54129967 AGAAATATGCAAATGGTGGTGGG + Intronic
1069276638 10:66599441-66599463 AGAAATGGGCCAAAAATTGAAGG - Intronic
1070203682 10:74233533-74233555 AGAAATTTGCAAAAAATTTAGGG - Intronic
1071073435 10:81723619-81723641 AGAAATGAACAAAGAATGGATGG + Intergenic
1071716891 10:88106124-88106146 AGAAATGGGAAAAAGAGGGGAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072167082 10:92824230-92824252 AGACATGTTCAAAAGATTTATGG + Intergenic
1072997984 10:100263366-100263388 AGAAATGTGCTAAACCTTGAAGG - Intronic
1073633126 10:105168850-105168872 ATAAATGTTGAAAAGATGCATGG + Intronic
1074262662 10:111870016-111870038 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1075069620 10:119312314-119312336 AGAGCTGTGCAAAAGCTGCAAGG + Intronic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1075695970 10:124435546-124435568 ATAAATGTGCAAAAGAAGAGAGG + Intergenic
1075827982 10:125376832-125376854 AGGAATGTGCTCCAGATGGATGG + Intergenic
1076287617 10:129315503-129315525 ATCAATGGGTAAAAGATGGAGGG + Intergenic
1076506169 10:130973902-130973924 AGACATGTGCAAATGATAGAAGG + Intergenic
1077718772 11:4606752-4606774 AGAAATTTGCCCAAGATAGATGG - Intronic
1077872512 11:6273658-6273680 AGAAATGGAAAATAGATGGAAGG - Intergenic
1078713012 11:13813253-13813275 AGAAATGTGCATAAGTGGCAAGG - Intergenic
1079461743 11:20686559-20686581 AGTGATGTACAAAAAATGGAAGG + Intronic
1079704401 11:23595868-23595890 AGAAATGTGCAATAGATCAATGG + Intergenic
1080123903 11:28708684-28708706 AAAAATTTAAAAAAGATGGATGG + Intergenic
1081890088 11:46534073-46534095 AGAAATGTATAAAAAATGTAGGG - Intronic
1082210153 11:49490504-49490526 AGAAAAGAACAAAAGAAGGAAGG - Intergenic
1082268230 11:50142649-50142671 AGAAATGTGCATAAGTAGCATGG + Intergenic
1082642305 11:55678060-55678082 AGAAATATGAAAATGATGTAAGG + Intergenic
1082808433 11:57464155-57464177 AGACATGGGAACAAGATGGAAGG + Intronic
1084020239 11:66412967-66412989 AGAAATTTTTAAAAGATGGAAGG - Intergenic
1084514001 11:69625844-69625866 AGAAATGTGGAAAATCAGGAGGG - Intergenic
1085194392 11:74659426-74659448 AGAAATTTGCAAAAGTAGTAAGG - Intronic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1086493227 11:87376625-87376647 AGAAAAGTTTAAAAGTTGGATGG - Intergenic
1086498486 11:87427834-87427856 GGAAAGTTGCAGAAGATGGAGGG + Intergenic
1086639514 11:89135031-89135053 AGAAAAGAACAAAAGAAGGAAGG + Intergenic
1087004803 11:93459171-93459193 AGCAATGGGACAAAGATGGATGG + Intergenic
1087081501 11:94175138-94175160 AGAAATATGGAAAAGCTGCAGGG - Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1087610539 11:100429044-100429066 GGAGATGTGCAAAAGAGAGATGG - Intergenic
1087760876 11:102103319-102103341 AGAAATGTTCAAAAGAGGGAGGG - Intergenic
1088434288 11:109793922-109793944 AAAAATGTTCTGAAGATGGATGG + Intergenic
1089043218 11:115473997-115474019 AAAAATAGGCAAAATATGGACGG + Intronic
1089196971 11:116699572-116699594 AGGAATCTGCAAAGGAAGGAGGG - Intergenic
1089207324 11:116774889-116774911 ACAAATGGGCAGAAGATGGGTGG - Intergenic
1089467232 11:118693146-118693168 AGGAATGTGCAAAATATGTTGGG + Intergenic
1090253524 11:125267151-125267173 TGAAATTTTCAAATGATGGAGGG - Intronic
1090470537 11:126977215-126977237 AAAAAGGTACAAAAGATGGCAGG - Intronic
1090693046 11:129205653-129205675 ATAGATGTTCAAAAAATGGAAGG + Intronic
1091067019 11:132524152-132524174 AGTAATGTGAAAAAGTTGCAGGG - Intronic
1093200167 12:16177045-16177067 AAAAATGTGGGAAAGAGGGAAGG + Intergenic
1093501172 12:19814292-19814314 AGAAGTGTGGAAAAGTAGGATGG - Intergenic
1093819879 12:23601235-23601257 TGCAATTTGCAAAAAATGGAAGG - Intronic
1094552863 12:31469449-31469471 AGAGAGGTGCAAAAGGTGTAGGG - Intronic
1094675908 12:32620308-32620330 AGAAATGTTCATAAGAGGCAAGG + Intronic
1094684168 12:32694378-32694400 TGAAATGTCCAAAATATGGCCGG - Intronic
1095611461 12:44133446-44133468 TGAAATGTTCACAAGATGGGTGG + Intronic
1095644652 12:44529278-44529300 AGATATGAGGAAAAGAAGGAAGG + Intronic
1096166528 12:49430075-49430097 AGAAATATGAAAAAGATGGCCGG - Intronic
1096819668 12:54224054-54224076 AAAAAAGTGCAAAATAGGGACGG + Intergenic
1096881029 12:54670817-54670839 TGAAATGTGGAAGAGATGGTAGG - Intergenic
1097723728 12:63050948-63050970 ATAAATGGGGAAAAGAAGGAGGG - Intergenic
1097781745 12:63714584-63714606 AGAAATGTGCAGAAGTTAGTAGG + Intergenic
1097968964 12:65611706-65611728 GGAAATGAGAAAAAGAGGGAAGG - Intergenic
1098282395 12:68874624-68874646 AAAAATGTGAAAAAGATCGTTGG + Intronic
1099067560 12:78002309-78002331 AGAAATGGCAAAAAGATGGTAGG - Intronic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099656818 12:85503561-85503583 AGCAATGTGAAAAGTATGGAAGG - Intergenic
1100126261 12:91430082-91430104 AGAAATAGACAAAATATGGAGGG + Intergenic
1100166301 12:91921633-91921655 CGAAATATGCAGAATATGGATGG - Intergenic
1100660103 12:96687439-96687461 AGAAATTTGAAAAGTATGGAGGG + Intronic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1101037907 12:100723116-100723138 AGAAATTTACAAAATATGAAGGG - Intronic
1101342040 12:103850793-103850815 AGATAACTGCAAAAGATTGAGGG + Intergenic
1101564602 12:105893896-105893918 AGAAATGTGGAAGAAAGGGAGGG + Intergenic
1101586237 12:106088319-106088341 AGAAAAGTGGATGAGATGGAGGG - Intronic
1102523121 12:113491860-113491882 AGAAATGTGCAAAGGTAGGAAGG + Intergenic
1102535544 12:113577851-113577873 AGAAAAGAGGAAATGATGGATGG - Intergenic
1102701511 12:114843400-114843422 AGACATGTGCTAAAGAATGAGGG + Intergenic
1103924519 12:124416254-124416276 AAAAATGAGCAAAAGAAAGAGGG + Intronic
1104122067 12:125809120-125809142 AGGAAGGGGCAGAAGATGGAGGG + Intergenic
1105541751 13:21321848-21321870 AAAAATGTTCTGAAGATGGATGG + Intergenic
1105810564 13:23991646-23991668 ACAAATGTGCACAATATGCACGG - Intronic
1106262366 13:28078650-28078672 AGAAATTTGCATAAGTTGCAAGG - Intronic
1107884573 13:44864643-44864665 TGAAATGTGCAAATGATGGCTGG + Intergenic
1107892396 13:44925714-44925736 AGAAATGTCAAAAAGAAGGTAGG + Intergenic
1108034044 13:46268961-46268983 AAAAATGTGCAAAACATTTATGG + Intronic
1108039497 13:46326233-46326255 AGAGATGAGAAAGAGATGGAAGG + Intergenic
1108779931 13:53817197-53817219 AGAAATGTCCAAAAAATTAAGGG - Intergenic
1109085751 13:57969229-57969251 AGAAAGGAGGAAAAGAAGGAAGG + Intergenic
1109989722 13:70039039-70039061 AAAAATGTGCAAAGGATATATGG - Intronic
1110058301 13:71006414-71006436 ATAAATGTGCAAAAGCTGCTTGG - Intergenic
1110458281 13:75714797-75714819 AGTAATGTTTAGAAGATGGAGGG + Intronic
1110758154 13:79200607-79200629 AGAAATATGCCAAAAATGTATGG - Intergenic
1110821070 13:79916910-79916932 AGTAATGAGCAAAAGATCGTTGG - Intergenic
1111535516 13:89597845-89597867 AAAAATGTGAAAAAGAGAGATGG + Intergenic
1111627338 13:90806281-90806303 ATAAATGTTCAAAAGATGAGAGG + Intergenic
1111649323 13:91069333-91069355 AGAAAAGAGAAAAAAATGGAGGG - Intergenic
1112807927 13:103183502-103183524 AGAAATGTGCAGAAGTTCAAAGG + Intergenic
1112855226 13:103760443-103760465 AGAAAAGTATAAAAGATGCAAGG + Intergenic
1113037748 13:106069980-106070002 AGAAATGGGACAAGGATGGAGGG - Intergenic
1114031021 14:18581695-18581717 AGCTATGCGCACAAGATGGATGG + Intergenic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1115718378 14:36131206-36131228 AGGAATGAGGAAGAGATGGAAGG + Intergenic
1116503773 14:45652692-45652714 AAAAATGTGAAAAAGAGAGATGG + Intergenic
1116613026 14:47102553-47102575 AGAAAAGGGCAAAACAAGGAAGG + Intronic
1116968191 14:51036901-51036923 AGAAATATACACAATATGGATGG - Intronic
1117216388 14:53556876-53556898 AAAAATGTGAAAAAGAGAGACGG + Intergenic
1117945839 14:61019506-61019528 AGAAATATTCAGAAGATAGAAGG - Intronic
1118721091 14:68594321-68594343 AGACATGTGCAAAAGAATGCGGG - Intronic
1118731625 14:68670861-68670883 AGAGATGAGCAGGAGATGGATGG - Intronic
1119604959 14:76007622-76007644 AGAAATGTGCATAATATTGAAGG - Intronic
1120442189 14:84555976-84555998 AGAAAGCTGGAAAAGGTGGATGG - Intergenic
1121105463 14:91276400-91276422 AGAAATGTTTAAATGAAGGAAGG + Intronic
1122468379 14:101949499-101949521 AGAAATTTACAAAAGAGGCAGGG + Intergenic
1123054138 14:105561257-105561279 TGAAACGTGCAAAGAATGGAGGG + Intergenic
1123078721 14:105681674-105681696 TGAAACGTGCAAAGAATGGAGGG + Intergenic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1124695890 15:31863779-31863801 AGAAATGTGCATAAGTAGCAAGG - Intronic
1125993551 15:44134051-44134073 AGATGTGTTCAAAAGATAGATGG + Intronic
1126678313 15:51181050-51181072 AGGAATGTCCACAAGATAGAAGG - Intergenic
1126881318 15:53101204-53101226 AGGACTGTGCAAAAGATAGTGGG + Intergenic
1127146235 15:56026902-56026924 GGAAATGAGCAAATGATGGGGGG - Intergenic
1127364960 15:58280411-58280433 AGCAATGAGACAAAGATGGAAGG + Intronic
1128029974 15:64471465-64471487 AGTAATGTGCTATAGATGGCTGG - Intronic
1128186937 15:65650683-65650705 AGAAAGGTGTAGAAGATGGAGGG + Exonic
1128734332 15:70044267-70044289 AGGAATGGGGAGAAGATGGAAGG - Intergenic
1129557928 15:76532765-76532787 GGAAATATAGAAAAGATGGATGG + Intronic
1129582525 15:76827673-76827695 AAAAAAATGCAAAAGATGAATGG + Intronic
1129789218 15:78329589-78329611 AGGGAAGTGCAAGAGATGGAGGG - Intergenic
1131318036 15:91357974-91357996 AGAAAAGTGCAAAAGAGAAAGGG + Intergenic
1131794983 15:96007071-96007093 AGAAAAGAGCAAACGAAGGAGGG - Intergenic
1133323939 16:4931925-4931947 AGAACTGGGCAAGGGATGGAGGG + Intronic
1134535003 16:15019249-15019271 AGAAGGGTGCAAAAGGTGGAGGG + Intronic
1134592777 16:15469424-15469446 AGAAATATGAATAAGCTGGAAGG - Intronic
1134728801 16:16442873-16442895 AGAAATGAGTAATACATGGATGG + Intergenic
1134938642 16:18269051-18269073 AGAAATGAGTAATACATGGATGG - Intergenic
1135605215 16:23818626-23818648 ACACATGTGAAACAGATGGAGGG - Intergenic
1137005815 16:35273703-35273725 AGAAAATTACAAAAGCTGGAGGG - Intergenic
1137891595 16:52168691-52168713 TGAAATTTGCAAAAGTTGGTAGG + Intergenic
1138946159 16:61852793-61852815 AGGGATGTGCAAAAGAAGCAGGG - Intronic
1139310002 16:66020413-66020435 AGAAATGAAGAAAAGGTGGAGGG + Intergenic
1139861043 16:70021518-70021540 AGAAGTGTGCAAAAGATGGAGGG - Intergenic
1140417504 16:74786619-74786641 AGGAATTTGAAAAAGATGGAGGG - Intergenic
1140905422 16:79405195-79405217 GGGAATGTCCAAAGGATGGAGGG + Intergenic
1142341757 16:89528026-89528048 AGTGATGTACAGAAGATGGAGGG + Intronic
1142840283 17:2623195-2623217 AGAAATCTGCATAAGAAGCAAGG - Intronic
1143069816 17:4281951-4281973 AGAAAGGAGTCAAAGATGGAAGG - Intronic
1143707368 17:8708152-8708174 AGGAACTTGCAACAGATGGAAGG + Intergenic
1143970115 17:10789307-10789329 TGAAATGTGAAAGAGATGGGAGG + Intergenic
1144365612 17:14541704-14541726 AGAAAGGAGCAAGGGATGGAGGG - Intergenic
1144542882 17:16161728-16161750 AGAAATATGCCATAGCTGGATGG - Intronic
1145301584 17:21644542-21644564 AGAAATGTGCCATAGCTGGATGG + Intergenic
1145348721 17:22058773-22058795 AGAAATATGCCATAGCTGGATGG - Intergenic
1146238354 17:31188767-31188789 AAAAATGTGAAAAAGAGAGATGG + Intronic
1149136420 17:53370625-53370647 AGAAATGTGAGAAAGATACATGG + Intergenic
1150727293 17:67661619-67661641 AGAAATGTGGTCAAGGTGGAAGG + Intronic
1151110963 17:71677141-71677163 AAAGTTGTACAAAAGATGGATGG + Intergenic
1151149695 17:72074474-72074496 AAAAATCTGCAAATGATGGAAGG + Intergenic
1151556889 17:74851220-74851242 AGACGTGTGCAAAAGATTGTGGG - Intronic
1151616453 17:75215863-75215885 AGGAAAGAGCAGAAGATGGAAGG - Intronic
1203192531 17_KI270729v1_random:203352-203374 AGAAATATGCCATAGCTGGATGG + Intergenic
1203201896 17_KI270730v1_random:2787-2809 AGAAATATGCCATAGCTGGATGG + Intergenic
1152953485 18:13980-14002 AGCTATGCGCACAAGATGGATGG - Intergenic
1153209634 18:2746766-2746788 AAAAGTTTACAAAAGATGGAAGG - Intronic
1153692973 18:7612262-7612284 ATAAATGTGCAAAATGTGTATGG + Intronic
1154246508 18:12703810-12703832 AGTAGTATGCAAAAGATGGAGGG + Intronic
1156240387 18:35247964-35247986 TAAAATTTGCAAAAGATGGTTGG - Exonic
1156775554 18:40783818-40783840 TGAAATGTTCAAAAAATGTAGGG - Intergenic
1156940921 18:42766625-42766647 AGAAATTTGCATAAGTAGGAAGG + Intronic
1157216090 18:45784857-45784879 AGAAATGACCAAAAGATGGCTGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158189571 18:54811295-54811317 TGACATGTGCCAAAGATGGCTGG + Intronic
1158269551 18:55697914-55697936 AGAAATGGGCAAAAACTGTAAGG + Intergenic
1158535004 18:58300395-58300417 AGACTTGTGCACTAGATGGAAGG - Intronic
1158833207 18:61303154-61303176 AGAAATTTGCATAAGAAGCAAGG + Intergenic
1159856340 18:73594070-73594092 AGAAATGTAGAATAGAGGGAAGG + Intergenic
1160040336 18:75339342-75339364 AGATATGAGCAGAATATGGATGG - Intergenic
1160048323 18:75408105-75408127 AGAAACTTGAAAAAGAGGGAAGG - Intronic
1160233533 18:77067483-77067505 ACAAATGTGAACAAGCTGGATGG - Intronic
1160323244 18:77915680-77915702 AGAAATGGGCAAAATGAGGAAGG + Intergenic
1160637417 19:89536-89558 AGAAAAGTGGAGGAGATGGAAGG - Intergenic
1162097199 19:8317268-8317290 AGAAATGCTCAAAACAAGGATGG + Intronic
1163383578 19:16985418-16985440 AGAAAGGAGGAAAAGAAGGAGGG + Intronic
1163928290 19:20365477-20365499 AGAAAACTGCAAAAACTGGAGGG + Intergenic
1164499396 19:28802831-28802853 AGCCATATGCAAAAGATTGATGG + Intergenic
1164788027 19:30952246-30952268 AGGAAGGAGCAAAAGAGGGAGGG - Intergenic
1165550832 19:36584090-36584112 AGAAATCTTGAAAAGAAGGAAGG + Intronic
1166736191 19:45086512-45086534 AGACATGTGCCAAACATGGTAGG + Intronic
1167168988 19:47818430-47818452 ATAAATGTGAAAGAAATGGATGG - Intronic
926235652 2:11041435-11041457 AGAAATGTGGACAAGCTGGAAGG - Intergenic
926249458 2:11145754-11145776 AGAGAGGGGCACAAGATGGAGGG + Exonic
926931529 2:18046199-18046221 AGAATTATGCAAAATTTGGAGGG + Intronic
928169940 2:28997274-28997296 AAAAACTGGCAAAAGATGGAAGG + Intronic
928200467 2:29244718-29244740 AGGAATTAGGAAAAGATGGATGG - Intronic
928231425 2:29501782-29501804 AGAAATGTTCTAGAGATGGATGG - Intronic
930459810 2:51658759-51658781 TGAAATGTGCAGAAGCTGGGTGG - Intergenic
930897126 2:56459526-56459548 ATAAATCTGGCAAAGATGGATGG + Intergenic
931812111 2:65864091-65864113 AGCAGTGTGCAGAAGATGGCAGG + Intergenic
932507027 2:72244231-72244253 AGAAATGTAAAAAAGAAAGATGG + Intronic
933347634 2:81109467-81109489 AGGAATGTGGGAAAAATGGAAGG - Intergenic
933352036 2:81165978-81166000 TGAAATGAACAATAGATGGAGGG - Intergenic
933479138 2:82833067-82833089 AGAAAGGTCCAGAAGAAGGATGG + Intergenic
934922743 2:98359255-98359277 ATACATGTGCAAAAGCTGAAGGG - Intronic
935727660 2:106037820-106037842 GGAAATATGAAAAAGCTGGAAGG + Intergenic
935932644 2:108145215-108145237 AGAAATGTGGAGTAGATGTAAGG - Intergenic
936074650 2:109394117-109394139 AGAACTGTTTAAAGGATGGATGG + Intronic
936135162 2:109886023-109886045 AGAAATCTGCAAAATATCAAAGG - Intergenic
936209535 2:110485462-110485484 AGAAATCTGCAAAATATCAAAGG + Intergenic
936428721 2:112440714-112440736 AGAAATCTGCAAAATATCAAAGG + Intergenic
936805439 2:116326119-116326141 AGAAAACTGCAAAATATGAATGG - Intergenic
937515236 2:122646740-122646762 AGAACTGTGCAAAACATTGCTGG - Intergenic
937575511 2:123416447-123416469 GGAAATCTGAAAGAGATGGATGG + Intergenic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
937729592 2:125212384-125212406 AGATATCTGAATAAGATGGATGG - Intergenic
938197244 2:129339214-129339236 AGAAATGTGGAACAGAAGCATGG - Intergenic
938244761 2:129767968-129767990 AGAAACGTGCACAAAATGGAAGG + Intergenic
938497184 2:131804079-131804101 AGCTATGCGCACAAGATGGATGG - Intergenic
939152729 2:138492705-138492727 AGGATTGTGCAAAAGATAAAAGG - Intergenic
939676470 2:145078493-145078515 ATAAATATGCGAGAGATGGAAGG - Intergenic
939697307 2:145342850-145342872 AGAAATTGGAATAAGATGGATGG + Intergenic
939762516 2:146200165-146200187 AGATATGTGCAAAAGAAAGTAGG + Intergenic
940216466 2:151308699-151308721 AGAGATGTGCAAAAGATGGTTGG + Intergenic
940393568 2:153161833-153161855 AAACAAGTGCAAAAGATTGATGG - Intergenic
940891519 2:159040783-159040805 AGAAATGGAAAAAAGCTGGACGG - Intronic
940935094 2:159483925-159483947 AAATATGTGCAAAAGATGAAGGG + Intronic
941025306 2:160450015-160450037 AGGAATCTGCAAAAGAAGGAGGG - Intronic
941383458 2:164823904-164823926 AGAAATGTTCAACAGGTGAAAGG + Intronic
942070906 2:172314398-172314420 AGAAATGTGAACAATGTGGAGGG + Intergenic
942307336 2:174621590-174621612 AGAAAATTGCAAAATATGCATGG - Intronic
943377488 2:187097733-187097755 AGAAAAATGCAAAAGAAGAAGGG - Intergenic
943924105 2:193748833-193748855 AGAAAGGTTGAAAATATGGAGGG + Intergenic
944318477 2:198308718-198308740 AGAAGTTTCCAAAAGATGCAAGG - Intronic
944461176 2:199952483-199952505 AAAAATGAGCAAACGATTGAGGG - Intronic
945267279 2:207902860-207902882 AGAAATGTTCAGTGGATGGATGG - Intronic
945331239 2:208541459-208541481 AAGAATGAGGAAAAGATGGAAGG - Intronic
945600346 2:211855161-211855183 AAAAATGTGCAAAATCTTGAAGG - Intronic
945989053 2:216378263-216378285 TGAAATGTTCCAAACATGGAAGG + Intergenic
946620919 2:221561693-221561715 AGAAAAGAGAAAAAGATGGTGGG - Intronic
947434160 2:230058549-230058571 AAAAAAGTTCTAAAGATGGATGG + Intronic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
947984498 2:234437108-234437130 AGAAAGGTAAGAAAGATGGAGGG + Intergenic
948079412 2:235193281-235193303 GGAAATGTGCATAAAATGGAAGG + Intergenic
1168806765 20:676282-676304 AGAAAAGTGCAAAAGAGAGGGGG + Intergenic
1169025208 20:2364964-2364986 GGAAATGTGCATAAGGTTGACGG + Intergenic
1169256635 20:4104905-4104927 ACAAATATGGCAAAGATGGAGGG - Intergenic
1169779929 20:9298045-9298067 AGAAAACTGCAGAAGCTGGAAGG + Intronic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170530975 20:17291154-17291176 AAAAATGAGCAAATGAGGGAAGG - Intronic
1170877246 20:20261937-20261959 AAAAATGAGAGAAAGATGGAGGG + Intronic
1171146596 20:22789535-22789557 AGAAATATGCAAAAGAGCAAAGG - Intergenic
1171203487 20:23260475-23260497 AGAAAAATGTAAAAGATTGAGGG + Intergenic
1171954968 20:31454692-31454714 CTAAATGGGCAAAAGATGCATGG + Intergenic
1173133195 20:40413927-40413949 AAAAATGAGAAAAAGATGCAAGG + Intergenic
1173843997 20:46176753-46176775 AGAGAAGTGGGAAAGATGGATGG + Intronic
1174090622 20:48044223-48044245 AGAAATGTGCCAAGGAAGGGAGG - Intergenic
1174127569 20:48318262-48318284 AGAAGAATGGAAAAGATGGAGGG + Intergenic
1174654970 20:52163717-52163739 ATAAATGTGTATAAGATGCAGGG - Intronic
1175357895 20:58383393-58383415 AGAAATCTGCAAAACCTGGCTGG + Intergenic
1175638053 20:60602166-60602188 AGTATTGTGCAAGAGAAGGATGG + Intergenic
1176652325 21:9562338-9562360 AGAAATATGCCATAGCTGGATGG + Intergenic
1177393258 21:20502626-20502648 AGAAATTTGCATAAGAAGCAAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177786804 21:25680344-25680366 AGAGATGGGAAAGAGATGGAAGG + Intronic
1177955096 21:27588421-27588443 AGAAAGGAACAAAAGATGGAAGG + Intergenic
1178170497 21:30034758-30034780 AGAGATGGGCAAAAGAGGCAGGG - Intergenic
1178265506 21:31138983-31139005 AGAAATGTGCAAAAGATGGAAGG - Intronic
1178945374 21:36942766-36942788 AAAAATGGGCAAAGGATGTAAGG + Intronic
1179043345 21:37824383-37824405 AGAAATGACCAAAAACTGGATGG + Intronic
1180242358 21:46518540-46518562 AAAAATGTGTAAAAGATTCAAGG - Intronic
1180280973 22:10695136-10695158 AGAAATGTGAAAAGAATGAATGG - Intergenic
1181523480 22:23462908-23462930 AAAAAAGTGCAAAAGATACATGG + Intergenic
1181688922 22:24547535-24547557 AAAAATGTGCAAATGATGGCCGG + Intronic
1182917028 22:34043445-34043467 AGCAATGGGCAAAGGATGCACGG + Intergenic
1184586040 22:45448776-45448798 AGCCATGTGCACAAGATGAATGG + Intergenic
1184898517 22:47427191-47427213 TGACAGATGCAAAAGATGGATGG + Intergenic
949267734 3:2179026-2179048 AGAAATGTGAGTAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
949685596 3:6566165-6566187 AGAGATGAACAAAAGGTGGAGGG - Intergenic
949991256 3:9581101-9581123 GAAAATCTGCAAAAGGTGGATGG + Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951014471 3:17714983-17715005 TTAAATGTGCAAAGGAAGGAAGG + Intronic
951037173 3:17946184-17946206 AGAAATTTGAAAAAGATAAATGG + Intronic
951097792 3:18652061-18652083 GGAAATGTGAACAGGATGGAAGG - Intergenic
951172647 3:19559882-19559904 AGAAATGGGAACAAGATAGAAGG - Intergenic
952876922 3:37953572-37953594 AGAAATGGGCAAAATATACAAGG + Intronic
953583649 3:44180011-44180033 AAAAATGTGCAAACAATGGGTGG - Intergenic
954651905 3:52170112-52170134 AGAAATGAGCAAAAGGGGGTGGG - Intergenic
954859492 3:53675599-53675621 AGAAAAGAGAAAAAGATGGGCGG + Intronic
954940854 3:54371822-54371844 AGAAATCTCCAAAAGTTGAAAGG + Intronic
955861859 3:63339509-63339531 AGAAATCTGAAAAAGATAGGTGG - Intronic
955877996 3:63513766-63513788 ATGAATGTACAAATGATGGAAGG + Intronic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956670206 3:71681987-71682009 AGAAATGTGGAAAAGTTGGGGGG + Exonic
957612302 3:82483940-82483962 AGAAAAGTGGATAAAATGGAGGG + Intergenic
957915557 3:86683291-86683313 AGAAATTGGCAAGAGAGGGATGG - Intergenic
958269711 3:91484538-91484560 AGCAGGGTGCAAAAGATAGATGG - Intergenic
958799101 3:98735460-98735482 AGAGATGTGCAGAAGATAGAAGG - Intronic
959271477 3:104216463-104216485 AGACCTGTGGAACAGATGGAGGG + Intergenic
959289278 3:104452134-104452156 ATAAATGGACAAAAGCTGGATGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960772067 3:121205327-121205349 AGAGATGTGCAAGAGAGGGAAGG + Intronic
961031356 3:123607075-123607097 ACAACTGTACTAAAGATGGAAGG - Intergenic
962872788 3:139512603-139512625 AGAGTTGTTCAAAAGATGGTGGG + Intergenic
963410241 3:144918158-144918180 AGGCATGTGCAAAAGGTAGATGG - Intergenic
963438092 3:145298024-145298046 AGAAAAGTGTACAAGATAGATGG + Intergenic
963504132 3:146163091-146163113 AGAAATGTTCAGCAGATGGCTGG - Intronic
963630621 3:147725774-147725796 AAAAATGTGAAAAAGAGAGATGG + Intergenic
963690351 3:148492509-148492531 AGAAATGTGGAAATGGTTGATGG - Intergenic
964039432 3:152241462-152241484 AGAAATGTGAGAAAGATAGGTGG + Intergenic
964678925 3:159316380-159316402 AAAAATGTGAAAAAGAGAGATGG - Intronic
964729984 3:159854624-159854646 AGCGATGTGCAAAAGATGCTTGG + Intronic
964799137 3:160534422-160534444 AGAAATGTGCAAAACAGGCAGGG + Intronic
965342508 3:167507535-167507557 AAACATGTGCAAAAGATTGAGGG + Intronic
965503746 3:169487766-169487788 AGATATATGCAAAAAAGGGAGGG + Intronic
966022173 3:175227504-175227526 AGAAATTTGCAAAAATTGAAGGG - Intronic
966311951 3:178603461-178603483 AGAAATGGGCAAAGGAAGGAAGG + Intronic
966697984 3:182812812-182812834 AAAAAAGTTCAAGAGATGGATGG - Intronic
966701304 3:182854840-182854862 AAAAATGGGCAAAAGGTGGAAGG + Intronic
967221034 3:187248332-187248354 AGAAACATGCAAAAGATAAACGG - Intronic
967637218 3:191816877-191816899 AAAAATGTCCTGAAGATGGATGG + Intergenic
967702624 3:192611139-192611161 AGAAAAGAAGAAAAGATGGAGGG + Intronic
969997019 4:11323869-11323891 AGAAATTTGCAAAAGTTAAAAGG + Intergenic
970255221 4:14161266-14161288 AAACATTTGCAAAAGATAGATGG - Intergenic
971556578 4:28019919-28019941 AGAAATGTTTACCAGATGGATGG - Intergenic
971672947 4:29587336-29587358 GTAAATTTGCATAAGATGGAAGG + Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
973999932 4:56501836-56501858 AGAAAGGTGGAAAAGGTGGCTGG + Exonic
974094399 4:57346906-57346928 AGAGAAGTGCTAAATATGGATGG - Intergenic
974256419 4:59461062-59461084 ATAGATGTTCAAAAGATTGATGG - Intergenic
974525060 4:63040458-63040480 AGAAAGATGGAAAAGAAGGAAGG - Intergenic
974551288 4:63378828-63378850 ATAAATGTGTAAAAAATAGATGG - Intergenic
975362103 4:73482763-73482785 ATAAATGGGCAAAAGAAGGGTGG - Intronic
975771939 4:77734823-77734845 ATAAATGTCCAAAAGCTGGCAGG - Intronic
976009073 4:80465566-80465588 TAGAATGTGCACAAGATGGAAGG - Intronic
976405279 4:84655614-84655636 TGTATTGTGAAAAAGATGGAGGG - Intergenic
977464783 4:97370466-97370488 TGAAATGAGAAAAAGTTGGATGG - Intronic
978323369 4:107523035-107523057 AGAATTGTTCATAATATGGATGG - Intergenic
978542742 4:109836440-109836462 TGAAATGTGCAAATATTGGAAGG - Intronic
979644116 4:123047380-123047402 AAAAATGCGCAAAAGAAAGATGG - Intronic
980971519 4:139571795-139571817 AGAAATTTGCTAAAAAGGGATGG - Intronic
981169842 4:141609025-141609047 AGAACTGGGAAAAGGATGGAGGG + Intergenic
981285289 4:143010439-143010461 AGAAATGTGGAACAGATTCATGG + Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981866101 4:149420888-149420910 AGAAAAGTGGAAGAGATGGATGG - Intergenic
982946873 4:161635660-161635682 AGAAATAAGTAAAAGAGGGATGG + Intronic
983519595 4:168693465-168693487 AGAAAAGAGCAAGATATGGAAGG + Intronic
983920733 4:173341570-173341592 AGAAATAAGCCACAGATGGAAGG + Intergenic
984072249 4:175129549-175129571 ATAAATGAGTGAAAGATGGATGG - Intergenic
984548203 4:181131497-181131519 AGAAATAAGCAAAAGATTTAAGG - Intergenic
984883486 4:184430074-184430096 GGAAATGAACAAAAGAAGGAAGG - Intronic
985086190 4:186315128-186315150 AGAAATGAGTAAGAGAAGGAGGG + Intergenic
986688883 5:10297595-10297617 GAGACTGTGCAAAAGATGGAGGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988221296 5:28349542-28349564 AGAAATGTGCATAAGTAGCAAGG - Intergenic
988228007 5:28439009-28439031 AGAAAGGTGGAAGACATGGAAGG - Intergenic
988328048 5:29796789-29796811 AAAAATTTCCAAAAGATAGAGGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989164678 5:38422718-38422740 AAAAATGTGCAATAAATGGAAGG + Intronic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
989735472 5:44698644-44698666 AGAAATGGGTAAAAGATGTGGGG - Intergenic
990170161 5:53038929-53038951 AAAAAAGTGCAAAAGATAGCTGG + Intronic
990318449 5:54606781-54606803 GAAAATCTGAAAAAGATGGATGG - Intergenic
991005756 5:61826489-61826511 AGAAAAGTGTAAAATATGAAGGG + Intergenic
991482146 5:67092112-67092134 AGCAATGTGCACCAAATGGAAGG - Intronic
991628925 5:68634541-68634563 AGAAATTATAAAAAGATGGAAGG + Intergenic
992325842 5:75658873-75658895 AAAAATGTTCTGAAGATGGATGG - Intronic
992757361 5:79920839-79920861 AGAAATTTAAAAAATATGGAAGG - Intergenic
993922958 5:93829970-93829992 AGAAAAGTGCTAAATATGTATGG - Intronic
994066211 5:95545499-95545521 AGAAAGGTTAAAAATATGGAAGG - Intronic
994890370 5:105625784-105625806 ACAAATCTTAAAAAGATGGAAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
996565202 5:124872776-124872798 AGAAACGTGGGAAAGGTGGAGGG + Intergenic
996922519 5:128785406-128785428 AAAAATGTGAAAAAGAGTGATGG - Intronic
997123232 5:131197937-131197959 AAAAAAGTGCAAAAGTTGAAGGG + Intronic
997330155 5:133053993-133054015 AGAAATGTGACAAAAATTGAGGG - Intronic
998194327 5:140054369-140054391 AGAAATGAGCACTAGTTGGAGGG + Intergenic
998301804 5:141029304-141029326 AGAAATGTGCAGTAGCTGGAAGG - Intergenic
998426498 5:142033346-142033368 GGAAATGTGCTAAAAATGCAGGG - Intergenic
999061482 5:148640238-148640260 AGAAAGATGAAATAGATGGATGG - Intronic
999554362 5:152723823-152723845 GGAAAATTGCAAAAAATGGAAGG + Intergenic
999669429 5:153945500-153945522 AGAAATTTGCAAAAGTAGCAAGG - Intergenic
999793152 5:154961995-154962017 AGAAATGTGCAAAAGAACTCTGG - Intronic
999940625 5:156538833-156538855 AGAAATTTTGAAAAGATGAAGGG - Intronic
1000306477 5:159999460-159999482 AGAAATGTGACAAAGATAAAAGG - Intergenic
1000518044 5:162264378-162264400 AGAAATGGGCAAAAGATCTGAGG + Intergenic
1001563737 5:172686523-172686545 AGAAAGGTGCAAAACCTGCAAGG + Intronic
1001863747 5:175084280-175084302 AGAAATCTGCAAAAGGTTGGTGG + Intergenic
1002648848 5:180676795-180676817 TAAAATGGGCAAAAGATGGCTGG - Intergenic
1003221909 6:4167798-4167820 CCAAATGTTCAACAGATGGATGG - Intergenic
1003701871 6:8475256-8475278 AGAAAAGAGCAAAAGATGAAAGG - Intergenic
1003986116 6:11437007-11437029 AGAAACCGGCAAAAGATGCATGG + Intergenic
1004544950 6:16588770-16588792 ATAAATGAGCCAAAGAAGGAGGG + Intronic
1005236582 6:23769980-23770002 AGAAATGTGCAGAAAATGATAGG - Intergenic
1005674292 6:28137864-28137886 AGAAGGATGCAAAAGATGGATGG + Intergenic
1005938317 6:30541952-30541974 AGAAAGGTGAAAATGCTGGAAGG - Exonic
1006470492 6:34226070-34226092 AGAAATGGATAAAAGATGGAGGG - Intergenic
1007183098 6:39944914-39944936 AGCAAGGTGCAGAAGATGGAGGG - Intergenic
1007703682 6:43778847-43778869 AGAAAAGAGCAAAACAGGGAAGG - Intronic
1007913527 6:45539036-45539058 AGGAACGAGCCAAAGATGGAGGG - Intronic
1008228194 6:48949605-48949627 AAAAATTTGTAAAAGATGCAAGG + Intergenic
1008985446 6:57536834-57536856 AGCAGGGTGCAAAAGATAGATGG + Intronic
1009513761 6:64587346-64587368 ACAAATGTGTAAATGATGAAGGG - Intronic
1009916853 6:70006308-70006330 AGAACTGTGCAACCCATGGATGG - Intronic
1010167631 6:72935649-72935671 AGAAATAGGCATAAGCTGGATGG - Intronic
1010578868 6:77568825-77568847 AGAAATTTTCAAAAATTGGAAGG - Intergenic
1010949414 6:82017427-82017449 ACAAATGTTCTAAAGAGGGAAGG - Intergenic
1011032872 6:82942407-82942429 AGAAATTTGCATAAGATACAAGG + Intronic
1011045582 6:83078181-83078203 AGAAGTGTGAATAAGATTGAAGG + Intronic
1011147966 6:84239632-84239654 AAAAATGTGGAAAAAAAGGAAGG + Intergenic
1011257635 6:85439472-85439494 AAAAATGGGCAAAAGATCCAAGG - Intergenic
1011589676 6:88960141-88960163 AGAACTGTGCTTAAAATGGATGG + Intronic
1011796009 6:90952537-90952559 AAAAATGGGCAAGGGATGGATGG - Intergenic
1013226370 6:108121660-108121682 AGAGATGGGCAGAAGCTGGAAGG - Intronic
1014926545 6:127277667-127277689 AAAAATGTGAAAAAGAAAGATGG - Intronic
1015187776 6:130437790-130437812 AGAAAGGTGAAAAAGAGAGATGG - Exonic
1015301099 6:131653885-131653907 AAACATGTGGAAAAGATGCATGG - Intronic
1015839977 6:137466707-137466729 AGAAGTGGACAACAGATGGAAGG - Intergenic
1016556581 6:145345614-145345636 AGATAGGTGCATAAAATGGAAGG - Intergenic
1016929259 6:149387015-149387037 AGAAAATTGCAAATCATGGAAGG - Intronic
1017471351 6:154739870-154739892 AGAAAAGTGGAAAAGGTAGAGGG + Intronic
1017842999 6:158237339-158237361 AGAAAGGTGGAAAAGGTGGCTGG - Intronic
1018102826 6:160456547-160456569 AGAAATGTGCAGAAGGGGGTGGG + Intergenic
1019013109 6:168858683-168858705 ACCAATGTGCAGAAGATGCATGG - Intergenic
1019021907 6:168925920-168925942 AGGAAGGAGCAGAAGATGGAAGG - Intergenic
1020400418 7:7770393-7770415 GGAAATGTTTATAAGATGGAAGG - Intronic
1020755555 7:12198043-12198065 AAAAATGTATAAAAGGTGGATGG + Intergenic
1021177831 7:17470404-17470426 AAAAATGTACAAAAAATGAAAGG + Intergenic
1021248182 7:18290544-18290566 AGAACTGTGAAAAAGATAGTGGG + Intronic
1021330324 7:19330177-19330199 AGGAATGTACAAAATAAGGATGG + Intergenic
1022116692 7:27267304-27267326 ACAAAGGTGCAAATGAAGGAAGG - Intergenic
1022271885 7:28816206-28816228 AGAACTGAGAAAAAGAAGGAAGG + Intronic
1022359191 7:29642804-29642826 AGAAAATTACAAAAGCTGGAAGG - Intergenic
1023532929 7:41177203-41177225 AGAAGTATGCTTAAGATGGAAGG + Intergenic
1023693914 7:42825069-42825091 AGAAATGTGAGAAAGAAGGCAGG + Intergenic
1023786828 7:43716660-43716682 AGAAATTTGCAAAAGTAGCAGGG + Intronic
1024683126 7:51715085-51715107 AGATATGTGTAAAAGATTCATGG - Intergenic
1024873928 7:53999458-53999480 CGCAATGAGCACAAGATGGAAGG - Intergenic
1025969636 7:66310263-66310285 AGCAATGTTCAAAAGCAGGAAGG - Intronic
1026532498 7:71212001-71212023 AGAAATTTGCATAAGAAGCAAGG + Intronic
1026761074 7:73126106-73126128 AGAAATGGGAGAAAGATGGAGGG + Intergenic
1027037414 7:74934902-74934924 AGAAATGGGAGAAAGATGGAGGG + Intergenic
1027086147 7:75266553-75266575 AGAAATGGGAGAAAGATGGAGGG - Intergenic
1027969897 7:85066208-85066230 AGAAAGGAGCAAAAGAGAGAAGG + Intronic
1028278056 7:88883144-88883166 TGAAATTTGCAAATGATGGCTGG - Intronic
1028474308 7:91236826-91236848 TGAAATGGGCAAAAGATTCAGGG + Intergenic
1029391108 7:100274820-100274842 AGAAGTGAGCAAAAGGTGCATGG + Intergenic
1029392451 7:100284577-100284599 AGAAATGGGAGAAAGATGGAGGG - Intergenic
1032480888 7:132245988-132246010 GAAAATGTTCAGAAGATGGAGGG + Intronic
1032560131 7:132882002-132882024 AGAAATGTGCAAAAGACACAAGG + Intronic
1032662414 7:133999600-133999622 AAATATTTGCAATAGATGGAAGG + Intronic
1032869988 7:135975072-135975094 AAAAATTTGCATAAGAGGGAGGG - Intronic
1033399461 7:141008064-141008086 AGAGATCTGCAAAAGAGGGAGGG - Intronic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1034178835 7:149122226-149122248 GAAAATGGGCAAAAGATGGCCGG - Intronic
1037117777 8:15247057-15247079 AGAAATGTGCATAAGTAGCAAGG + Intergenic
1037501637 8:19491631-19491653 ATACATGAGCAAAAGATGAACGG - Intronic
1038138975 8:24822269-24822291 AGAAATTTGCATAAGTTGCAAGG + Intergenic
1038957378 8:32482463-32482485 AGTGATGTGCAAAGAATGGATGG - Intronic
1040108980 8:43557690-43557712 AGAAAATTGCAAAAGCTAGAGGG - Intergenic
1041149452 8:54916159-54916181 AGAAAAAGGCAATAGATGGAGGG - Intergenic
1041968989 8:63715107-63715129 AGGAAAGGGGAAAAGATGGAGGG + Intergenic
1042599069 8:70480064-70480086 AGATATGTGCAAATGATTGAAGG - Intergenic
1044563310 8:93635821-93635843 AGAAATATCCAAAATGTGGAGGG + Intergenic
1046145978 8:110158756-110158778 AGAAATGAGAAAAAGAAGGAAGG - Intergenic
1046170323 8:110497604-110497626 AGAAATGTGCATAAGTAGCAAGG + Intergenic
1046220883 8:111212842-111212864 AGAAAGATTCAAAAGATGTACGG + Intergenic
1046634902 8:116663461-116663483 AGAAATTTCCCAAAGATGAATGG + Intronic
1046931938 8:119850120-119850142 AGAAAAATTAAAAAGATGGAAGG + Intronic
1047132331 8:122035436-122035458 AGTAATGGGAAAAAGAGGGAGGG + Intergenic
1047539408 8:125749960-125749982 AAAAATGTTCTGAAGATGGATGG - Intergenic
1047580547 8:126210190-126210212 CTGAATGGGCAAAAGATGGAAGG - Intergenic
1047898323 8:129391772-129391794 ATAAATGTAGGAAAGATGGATGG + Intergenic
1048059048 8:130898613-130898635 ATAAATGTGAAAGGGATGGATGG + Intronic
1048157882 8:131978694-131978716 AGAAATGTGCAAAGTAATGAAGG - Intronic
1048536100 8:135296281-135296303 AGAAATGAGCAAAATAGGCAAGG + Intergenic
1048675199 8:136770276-136770298 AGAAATTTGCATAAGTTGCAAGG - Intergenic
1048959014 8:139560279-139560301 AGAAATGTCCAACAGATGAGTGG - Intergenic
1049348392 8:142151222-142151244 AACAATGGGCAAAGGATGGATGG + Intergenic
1050009808 9:1173718-1173740 AGAAATGTGAAAAAGATTAGCGG + Intergenic
1050408852 9:5339985-5340007 AGGAATGGGCAAATGAAGGAAGG - Intergenic
1051962465 9:22784497-22784519 AGATATGTGAATAAAATGGAAGG - Intergenic
1052517151 9:29496944-29496966 AGAAAAGTGGAAAAGAGAGATGG + Intergenic
1052736594 9:32348709-32348731 AGAAAAGTGCAAAATATGTCAGG + Intergenic
1053158911 9:35800121-35800143 CGAATTGTGGAAAAGATGCAGGG + Exonic
1053256513 9:36620923-36620945 AGAAATGTGCAAATGTTGGCAGG - Intronic
1054796099 9:69303396-69303418 AGAAATGGGGAAAAGATGAGTGG - Intergenic
1055161241 9:73130570-73130592 AGGAATGTGCTATTGATGGAGGG + Intergenic
1055633985 9:78256267-78256289 AGAAATGTGACTAACATGGAGGG + Intronic
1055706335 9:79008896-79008918 ATAAATGTACAAAAGAAGAAAGG + Intergenic
1055981343 9:82005316-82005338 AGAAATCTGAACAAAATGGAAGG - Intergenic
1056850761 9:90081792-90081814 AAAAATGTTCATAACATGGATGG - Intergenic
1057007265 9:91571438-91571460 AGCAATGTGCAGAAGATGATGGG - Intronic
1057987741 9:99734308-99734330 AAAAAAGTTCTAAAGATGGATGG + Intergenic
1058241103 9:102561200-102561222 AGGTAAGTGCAAAAAATGGATGG - Intergenic
1058579096 9:106435526-106435548 AGTGATGTGAGAAAGATGGAAGG - Intergenic
1059037461 9:110771384-110771406 AGAAATGAGCATAAGAGGGCTGG - Intronic
1059088515 9:111331316-111331338 AGAAATATGCAAAGAATGGTAGG + Intergenic
1059945165 9:119402148-119402170 AGAAGTGAGCAAAGGAAGGAAGG + Intergenic
1060160899 9:121362379-121362401 AAAAATGTTCATAACATGGATGG - Intronic
1061285137 9:129618371-129618393 AGAAATGGACAAATGATGGTGGG + Intronic
1061940897 9:133883210-133883232 TGAAATGAGCAAATGATGAAGGG - Intronic
1203630054 Un_KI270750v1:65884-65906 AGAAATATGCCATAGCTGGATGG + Intergenic
1185863436 X:3601008-3601030 ATAAATTTGCAACAGATGAATGG + Intergenic
1185893585 X:3840496-3840518 AGAAATTTGCATAAGTAGGAAGG + Intronic
1185898700 X:3878920-3878942 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1185903817 X:3917349-3917371 AGAAATTTGCATAAGTAGGAAGG + Intergenic
1186222131 X:7360844-7360866 AGAAGTGTGCATACAATGGAGGG + Intergenic
1186240716 X:7562574-7562596 CGAAATGTGCAAAAGGAGAATGG + Intergenic
1186553746 X:10535069-10535091 AGAAATGTGGAAATCATGGAAGG + Intronic
1187547679 X:20268192-20268214 AGAAATGTGTAAAAGTCGCAGGG + Intergenic
1188016031 X:25109545-25109567 AGAAAAGTTCTCAAGATGGATGG - Intergenic
1188164842 X:26849251-26849273 AGAAGCGTGCAAAAAAAGGAAGG + Intergenic
1188553893 X:31390169-31390191 ATAAATGTGTAAGTGATGGATGG - Intronic
1190095234 X:47474528-47474550 AGAAATGAGAAACAGATGGTTGG + Intronic
1190278309 X:48913344-48913366 AAGAATCTGCAAAAGTTGGAGGG + Exonic
1191601330 X:63012574-63012596 ACAAATGGACAAAAGAAGGAGGG - Intergenic
1191942618 X:66497687-66497709 AGAAATTTTAAAAAGCTGGAAGG + Intergenic
1193341745 X:80356161-80356183 AGAAATATGCAAATGTTTGAGGG + Intronic
1193341748 X:80356187-80356209 AGAAATTTGGAAAAGATAGAAGG + Intronic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1193666754 X:84328859-84328881 AGAAATGTGCCCAAGGTGGTTGG + Intronic
1193930036 X:87542284-87542306 AGAAATTTGCAAAAGAATCAAGG + Intronic
1194250091 X:91563576-91563598 AGAAATGAGGAAAAGAAAGAAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194483260 X:94454043-94454065 TGAAATGTGCCCAAGGTGGATGG + Intergenic
1194511865 X:94806548-94806570 AGGAATATGAAAAAGGTGGATGG - Intergenic
1194988953 X:100523744-100523766 AGAAATGTGCAAAAAATCTGAGG - Intergenic
1195235981 X:102898677-102898699 AAAAATGTGAAAAAGAGAGACGG - Intergenic
1195748586 X:108142709-108142731 AAAAATGTGAAAAAGAGAGATGG - Intronic
1195850028 X:109272967-109272989 AGAAATGGGACAAAGATGGGCGG - Intergenic
1195896898 X:109754488-109754510 AGAAAGGTGGAAAGGAAGGAAGG + Intergenic
1195943823 X:110188529-110188551 AAAAATGTCCAAAAAATGGAGGG + Intergenic
1195961588 X:110392956-110392978 AGACATGTGCAACAGATGCAAGG + Intronic
1196062531 X:111426584-111426606 AGAAATTTGAACAAGATGGCAGG + Intergenic
1196413297 X:115443410-115443432 GGAAATGTCCAAAAGATAGTTGG - Intergenic
1196607428 X:117672130-117672152 AGAACTGTGCAACCCATGGATGG - Intergenic
1198042696 X:132869813-132869835 ATGAATGGGCAAAAGCTGGAAGG + Intronic
1198058856 X:133023293-133023315 TGAAATGTGAAGAAGATGGTAGG - Intergenic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198734553 X:139771931-139771953 AGAAATTTGCATAAGAAGCAAGG + Intronic
1199046583 X:143181292-143181314 AGAAATGTGTAGTAGATGTATGG + Intergenic
1199354574 X:146846913-146846935 AGATATTTAGAAAAGATGGAAGG - Intergenic
1199558737 X:149139303-149139325 AGGAAAGTGGAAAAGAAGGAAGG - Intergenic
1200361278 X:155609705-155609727 AGAAATGGGCAAAATATGTGAGG + Intronic
1200406479 Y:2817036-2817058 ATGAATGAGCAAAAGCTGGAAGG - Intergenic
1200569053 Y:4804825-4804847 AGAAATGAGGAAAAGAAAGAAGG - Intergenic
1201550147 Y:15210561-15210583 AAGAAGGTGCAAAAGAGGGAGGG + Intergenic
1201625534 Y:16010916-16010938 AGAAAAGTGGCAAAGAAGGAAGG + Intergenic
1202168218 Y:22014767-22014789 TGAAAAGTGCAAAAGCTAGATGG + Intergenic
1202223143 Y:22571601-22571623 TGAAAAGTGCAAAAGCTAGATGG - Intergenic
1202319972 Y:23624059-23624081 TGAAAAGTGCAAAAGCTAGATGG + Intergenic
1202337537 Y:23827188-23827210 AGAAATGTACAAAAACTGGAAGG + Intergenic
1202533229 Y:25842883-25842905 AGAAATGTACAAAAACTGGAAGG - Intergenic
1202550796 Y:26045997-26046019 TGAAAAGTGCAAAAGCTAGATGG - Intergenic