ID: 1178267185

View in Genome Browser
Species Human (GRCh38)
Location 21:31154421-31154443
Sequence TGTACTCTTCGGAGCACAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178267185 Original CRISPR TGTACTCTTCGGAGCACAGG GGG Exonic
900653250 1:3741729-3741751 TGAGCTCTCCAGAGCACAGGTGG - Intergenic
903720931 1:25405108-25405130 AGTACTTTTCGGAGCCGAGGTGG + Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
907281715 1:53351356-53351378 TGTGCTCTTTTTAGCACAGGAGG - Intergenic
908673860 1:66578916-66578938 TGTACTTTGGGGAGCAGAGGAGG - Intronic
917475106 1:175362659-175362681 TGTACTCTTGTGCACACAGGTGG - Exonic
920867536 1:209765543-209765565 TGTAGTCTTAGGAACTCAGGAGG + Intronic
923304419 1:232675107-232675129 GGTGCTCTTGGGAGCAGAGGCGG - Intergenic
1075277693 10:121109533-121109555 TCTGCTGTTGGGAGCACAGGGGG - Intergenic
1077226466 11:1440996-1441018 TGTAGTCCTTGGGGCACAGGGGG - Intronic
1080756244 11:35202250-35202272 TGTACTCTTTAGAGCAAAGTTGG + Intronic
1090387390 11:126364930-126364952 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1092263779 12:6966006-6966028 TTTTCTCTTGGGAGCAAAGGAGG - Intronic
1103281124 12:119758830-119758852 TGTACTCTGAGGATCACAGATGG + Intronic
1105342550 13:19541046-19541068 TGTCCTCTTCTAAGCTCAGGTGG + Intergenic
1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG + Intronic
1112348057 13:98609144-98609166 TGTAATCTTCAGAGTAAAGGTGG - Intergenic
1113231481 13:108217813-108217835 TGTACACTTCAGTGCACAGGGGG + Intronic
1121110349 14:91308398-91308420 TGTGCTCTTAGAAGCACAGATGG - Exonic
1123904146 15:24905385-24905407 TGTAGTCTTAGCAGCTCAGGAGG + Intronic
1124650387 15:31469575-31469597 TGCCTTCTTCGAAGCACAGGAGG + Intergenic
1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG + Intronic
1128401669 15:67288768-67288790 GGTACTCTTCTAAGCACTGGAGG + Intronic
1128957945 15:71969463-71969485 TATACATTTCGGAGCAGAGGGGG - Intronic
1130878200 15:88032377-88032399 TGCACACTTCGGGGCACTGGAGG + Intronic
1141868170 16:86765427-86765449 TGTACTTTTCGAAGCTGAGGTGG - Intergenic
1144072896 17:11690202-11690224 GGTCCTCATCAGAGCACAGGAGG - Exonic
1146432289 17:32809238-32809260 TGTAGTCTTAGCAGCTCAGGAGG - Intronic
1159974763 18:74697260-74697282 TCTCCTCATAGGAGCACAGGAGG - Intronic
1161736920 19:5997128-5997150 TGTACTCGTCGTAGAGCAGGCGG + Exonic
934937260 2:98474442-98474464 AGGGCTCTTCGTAGCACAGGTGG - Intronic
940092394 2:149935012-149935034 GGTAATCTTCGGTGGACAGGAGG + Intergenic
940694330 2:156959684-156959706 TGGACACTGAGGAGCACAGGAGG - Intergenic
946985306 2:225265484-225265506 TCTAGTCTTTGGAGCACAGTAGG + Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
948222827 2:236287143-236287165 TTTACTCTTTGGAGGCCAGGGGG - Intergenic
1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG + Intergenic
1170071309 20:12372120-12372142 TGTTCTCTGAGGAGCACAGCTGG + Intergenic
1171178725 20:23075451-23075473 TGAGCTCTTCCCAGCACAGGAGG - Intergenic
1176984358 21:15419393-15419415 TATACTCTTGGGATCACAGCAGG - Intergenic
1177262410 21:18748462-18748484 TGTACTCTCAGGGGCCCAGGAGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1179975494 21:44863390-44863412 TGTGCTCTTGGGCACACAGGAGG - Intronic
1180149963 21:45942409-45942431 TGAACTCTGAGGAGCACAGAGGG - Exonic
1181597804 22:23928482-23928504 TCTACTCCTAGGAGCACAGTTGG + Intergenic
1182277246 22:29197972-29197994 TGCCCTCTTTGGAGCACAGTTGG - Intergenic
1183929842 22:41229727-41229749 TCTACTCTTCTGTGCCCAGGTGG - Exonic
1185052995 22:48563425-48563447 TGAACTCCTCTGGGCACAGGTGG + Intronic
959098849 3:101987390-101987412 TGTACTCTCCTGAGGTCAGGTGG + Intergenic
964473962 3:157082267-157082289 TGTACTCTTCAAAACACAAGGGG - Intergenic
966359065 3:179114920-179114942 TGTAGTTTTCGGAGCACTTGAGG + Intergenic
969787900 4:9473623-9473645 TTTACTCTCCGCAGCACGGGGGG - Intergenic
981479985 4:145228616-145228638 TGCTCTCTTCAGAGCACAGTTGG + Intergenic
984646948 4:182230868-182230890 TGTAATTATCGGAGAACAGGAGG - Intronic
991593398 5:68277934-68277956 TGTACTCAGTGGAGCAAAGGTGG - Intronic
997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG + Intronic
1003271529 6:4611825-4611847 TGCTCTCTTGGGAGCACGGGTGG - Intergenic
1003760182 6:9171212-9171234 TGTGCTCCTGGGAGAACAGGGGG + Intergenic
1004148080 6:13088849-13088871 TGTAATCTTGAGAGCCCAGGAGG - Intronic
1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG + Exonic
1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG + Intergenic
1036701214 8:11015289-11015311 TTTACTCTTCTGAGCACATCCGG + Intronic
1046019993 8:108653293-108653315 TATATTCTTCAGAGCACAGTGGG + Intronic
1062319546 9:135984110-135984132 TGTCCTCCTCTGAGGACAGGAGG - Intergenic
1193468828 X:81875843-81875865 TGTGCTCTTGGGAGCCCAGAAGG - Intergenic
1199583261 X:149382204-149382226 TGTCCTCTTCCGTGCAAAGGGGG + Intergenic
1202589791 Y:26470621-26470643 TGTCCTCTTCTAAGCTCAGGTGG - Intergenic