ID: 1178269879

View in Genome Browser
Species Human (GRCh38)
Location 21:31179651-31179673
Sequence GCGGTCTGAAGGAGGTAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178269872_1178269879 9 Left 1178269872 21:31179619-31179641 CCATGGATTTAGCGCACAGCCTC 0: 1
1: 0
2: 2
3: 4
4: 89
Right 1178269879 21:31179651-31179673 GCGGTCTGAAGGAGGTAACGTGG 0: 1
1: 0
2: 0
3: 2
4: 42
1178269875_1178269879 -10 Left 1178269875 21:31179638-31179660 CCTCCAAAGGTGAGCGGTCTGAA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1178269879 21:31179651-31179673 GCGGTCTGAAGGAGGTAACGTGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178269879 Original CRISPR GCGGTCTGAAGGAGGTAACG TGG Intronic
912229633 1:107777126-107777148 GCTATCTGAAGGAGGAAAAGTGG - Intronic
914385690 1:147167822-147167844 CTGGTCTGAAGGAGGCAAGGAGG - Exonic
919749485 1:201028008-201028030 GAGGTTTAAATGAGGTAACGTGG + Intergenic
920135169 1:203763673-203763695 GCAGTCTGAGGCAGGTAACTTGG + Intergenic
1063450127 10:6145356-6145378 CGGGTCTGGAGGAGGTAGCGCGG - Intronic
1069632102 10:69903206-69903228 GGGTTCTGAAGGAGGTAGTGAGG + Intronic
1076613288 10:131739415-131739437 GGGGGCTGAAGAAGGGAACGGGG - Intergenic
1085599701 11:77844235-77844257 GGGGCCTGTAGGAGGTAACTGGG - Intronic
1103397463 12:120619114-120619136 GAGGGCTGAAGGAGGAAAGGAGG - Intergenic
1104873476 12:132016951-132016973 GCGGCCTGAGGGAGGAAACCGGG - Intronic
1114659318 14:24334696-24334718 CCGGGCCGAAGGAGGTAACCCGG - Intronic
1115445805 14:33488139-33488161 GAGCTCTGAAGGAGGTAAGAAGG + Intronic
1115504668 14:34081737-34081759 GAGGTCTGAGGGAGGAAAGGTGG - Intronic
1116321524 14:43471852-43471874 GTGGTCTGAATGAGTTAAAGAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1128579029 15:68795955-68795977 GGGGTCTGAAGAAGGGAAGGAGG + Intronic
1138329997 16:56205834-56205856 GCGTTCTAAAGGAGGAAACTGGG + Intronic
1144579039 17:16447710-16447732 GCTGCCTGAAGGAGGTAAGATGG - Intronic
1147350695 17:39840866-39840888 GCAGTGTGAATGAGGTAAGGAGG + Intronic
1148085274 17:44990195-44990217 GGGGGCTGAGGGAGGCAACGAGG - Intergenic
1152910481 17:83002638-83002660 GCCGTCTGAGGGAGGGGACGTGG - Intronic
1162400648 19:10444581-10444603 GAGGCCTGAAGGAGGGAAAGAGG + Intronic
1166306721 19:41939808-41939830 TGGGTCTGAAGGAGGAAACTGGG - Intergenic
929457030 2:42073323-42073345 GCAGTCTGCAGGAGGGGACGTGG + Intergenic
930977606 2:57482744-57482766 GCAGTTTGAAGGAGGGAACTGGG - Intergenic
936906795 2:117545423-117545445 GCGGTCTGATGAAGGTAAAGTGG + Intergenic
948111042 2:235456304-235456326 GGGGTCTGAATGAGGGAATGAGG - Intergenic
1174366695 20:50060873-50060895 CCGGCCTCAAGGAGGTAACCAGG + Intergenic
1178269879 21:31179651-31179673 GCGGTCTGAAGGAGGTAACGTGG + Intronic
1182900143 22:33891114-33891136 GGGGTCTGAATGAGGCAAGGGGG - Intronic
1184247209 22:43241762-43241784 GTGGTCTGAAGGAGGGACCATGG - Intronic
954627261 3:52029279-52029301 GCTGTCTGGAGGAGATAACCTGG + Intergenic
959021338 3:101190764-101190786 GAGGTTTGGAGGAGGTAAAGAGG + Intergenic
970894968 4:21091828-21091850 GGGGTCTGTAGGAGGTAATCAGG - Intronic
993408856 5:87549140-87549162 AAGGTCTGAAGGAGGTAAATAGG - Intergenic
994258629 5:97631001-97631023 GCAGTCTGAAGAAGGTACAGTGG + Intergenic
1000314258 5:160073551-160073573 GCTGTCTAAAGGAGGGAAAGTGG - Intronic
1001068459 5:168560338-168560360 GAGGTTTGAAGGAGGTGAGGGGG - Intronic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1020591083 7:10138119-10138141 GGGGTCTTTAGGAGGTAACTAGG + Intergenic
1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG + Intergenic
1045330072 8:101147991-101148013 GCAGGCAGAAGGAGGTGACGTGG + Intergenic
1045756565 8:105550206-105550228 GAGTTTTGAAGGAGGTAAGGTGG - Intronic
1048076131 8:131073366-131073388 GAGGTCTGAAACAGGTAATGAGG + Intergenic
1059310712 9:113387338-113387360 GTGCTCTGAAGGAGGTCACCAGG - Exonic