ID: 1178275255

View in Genome Browser
Species Human (GRCh38)
Location 21:31231004-31231026
Sequence TTCTGGCCCCCTCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178275250_1178275255 29 Left 1178275250 21:31230952-31230974 CCATTCAATATTTTGAGCTCTTC 0: 1
1: 0
2: 1
3: 32
4: 294
Right 1178275255 21:31231004-31231026 TTCTGGCCCCCTCTGAAGCCAGG 0: 1
1: 0
2: 2
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178275255 Original CRISPR TTCTGGCCCCCTCTGAAGCC AGG Intronic
900494065 1:2968471-2968493 CTCTGTGCCCCTCTGCAGCCTGG + Intergenic
900818980 1:4871801-4871823 TTCTAGTCCCTTCTGCAGCCAGG + Intergenic
901187253 1:7382621-7382643 TTCTTGCCCCCACTGTAGCAAGG + Intronic
901422623 1:9161403-9161425 TTCTTGCCCCCTCTGTATCTTGG - Intergenic
902245393 1:15117480-15117502 TTCTCCCCTCCTCTGCAGCCTGG - Exonic
902259671 1:15215190-15215212 TTCTCGGCCGCGCTGAAGCCGGG - Exonic
902447774 1:16478126-16478148 ATCTGGACCCCTCTGATGTCGGG - Intergenic
902467675 1:16628337-16628359 GTCTGGACCCCTCTGATGTCGGG - Intergenic
904378143 1:30094590-30094612 TGCTGGCCCCTTCTGAGTCCTGG + Intergenic
905907029 1:41626079-41626101 TTCAGGCCCCTTCTGAAGAGTGG + Intronic
906356551 1:45111296-45111318 TCCTGGCCCCCTCTTCAGTCTGG - Intronic
907109135 1:51910523-51910545 TTCTGGCAGCCTCAGAAACCAGG + Exonic
908230903 1:62103979-62104001 TGCTGGCTCACTCTGAAGACAGG - Intronic
912017593 1:105060951-105060973 GTCTTGCACCCTCTGAAGCAAGG + Intergenic
912733355 1:112129036-112129058 TTCTGGACCCCGCTCAAGACTGG + Intergenic
913537902 1:119791709-119791731 TTCTGGCCCCGTCTAATGCAAGG - Intergenic
916463553 1:165049867-165049889 TACTTGCCCCCTCTGAACTCTGG + Intergenic
917095510 1:171395144-171395166 TTCTGGGCTCATTTGAAGCCTGG + Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
922548522 1:226476381-226476403 TGCTGGCCCCCTCAGAAAACAGG - Intergenic
1063365263 10:5486708-5486730 TCCTGGACTCCTCTCAAGCCAGG - Intergenic
1065553653 10:26893142-26893164 TTCGAGCCACCTCTGAAGACTGG + Intergenic
1065599509 10:27354479-27354501 TTCGAGCCACCTCTGAAGACTGG - Intergenic
1066422364 10:35274929-35274951 GTCTGGCCCCTGCAGAAGCCAGG - Intronic
1067682345 10:48449040-48449062 CTCTGGCCTGCTCTGAGGCCTGG - Intronic
1068061956 10:52079513-52079535 TTCTGTTTCCCTCTGAGGCCAGG + Intronic
1070547802 10:77466127-77466149 CTCTCTGCCCCTCTGAAGCCTGG + Intronic
1071480321 10:86060572-86060594 ATCTGCCCCGCTCTAAAGCCCGG + Intronic
1072039937 10:91597441-91597463 TTCTGGCCCCATCGGAGGACTGG - Intergenic
1073143025 10:101261381-101261403 TCCTGGCCCCCTCTGAGCCCCGG - Intergenic
1073467052 10:103700387-103700409 GTCTAGCCCCCTGTGAACCCAGG - Intronic
1073846997 10:107568070-107568092 GGCTTGCACCCTCTGAAGCCAGG + Intergenic
1075021090 10:118952979-118953001 CTCTTGGCCCCTCTGAATCCAGG + Intergenic
1075086636 10:119418296-119418318 TTCTGGTCCCCCCTGAAGCTGGG - Intronic
1075448317 10:122529340-122529362 TTCTGACCCCCTCCAGAGCCAGG + Intergenic
1076425606 10:130365375-130365397 TCCTGGTCCCATCTGATGCCAGG + Intergenic
1077708794 11:4515212-4515234 GCTTGGCCACCTCTGAAGCCAGG - Intergenic
1077932952 11:6752855-6752877 TTCAGACTCCCTCTTAAGCCTGG + Intergenic
1079806568 11:24938021-24938043 GTCTAGCCACCTTTGAAGCCAGG + Intronic
1081550892 11:44110996-44111018 TTCTTGCCTCCTTTGAATCCAGG - Intronic
1081845553 11:46238204-46238226 TTCTGGCCGCCTCGGAGGGCAGG + Intergenic
1081975819 11:47234112-47234134 TTCTGCCCCCTTCTGAACACTGG - Intronic
1082807796 11:57461270-57461292 TTCTGGCCACCTGGGAAGACAGG + Intronic
1084940925 11:72612888-72612910 GTCAGGCCTCCTCTGAAGCCAGG + Intronic
1085259397 11:75195695-75195717 CTTTGGCCTCCTCTGCAGCCTGG + Intronic
1085315477 11:75542291-75542313 TTCTGGACCCAGATGAAGCCTGG - Intergenic
1086435389 11:86775071-86775093 TTGTGGCCCACTCTGAAGAATGG + Intergenic
1089744769 11:120609082-120609104 GTCTGGCTCAATCTGAAGCCTGG + Intronic
1090643241 11:128746978-128747000 TTTTGACCCCATCTGCAGCCAGG + Intronic
1090853113 11:130587853-130587875 ATCTGGACCCCTCTCAAGGCTGG + Intergenic
1091604228 12:1936505-1936527 TTCTGCCTCCCTCAGAAGCCTGG + Intergenic
1091648953 12:2295152-2295174 TTCAGTCCCCTTGTGAAGCCTGG + Intronic
1091693419 12:2612042-2612064 TTCTGTCCACCCCTGATGCCTGG - Intronic
1091994495 12:4982579-4982601 GCCTGGCTCCCTCTGAAGCAGGG + Intergenic
1093060624 12:14599106-14599128 TTCTGGCCCCCAGTGACTCCAGG - Intergenic
1094106557 12:26817932-26817954 TTCTAGCCTCCTTTGTAGCCAGG - Intronic
1100428166 12:94506891-94506913 TTCTGGCCACTACTAAAGCCGGG - Intergenic
1101736587 12:107467880-107467902 ATCTTGAGCCCTCTGAAGCCAGG - Intronic
1101884006 12:108645965-108645987 CTCTGGCCCCCTCCGAGTCCGGG + Exonic
1102487277 12:113266783-113266805 TTCTGGCCCCCACTGAATGATGG - Intronic
1105313884 13:19239072-19239094 TTCTGCCCCAGTATGAAGCCGGG - Intergenic
1106571478 13:30932202-30932224 TTCTGCCCCTCTCCTAAGCCAGG + Intergenic
1106605410 13:31224044-31224066 TTCTGCACCCCTCAGAACCCAGG - Intronic
1107612915 13:42134272-42134294 CTGTGGCCCCCCTTGAAGCCTGG - Intronic
1107788617 13:43978571-43978593 CTCTGGCCCCTGCTAAAGCCTGG - Intergenic
1107968192 13:45615888-45615910 TTCTGGCCGCCGCTGACGACTGG - Intergenic
1108329236 13:49368520-49368542 TTCTGGCCACTTCTGAGTCCAGG - Intronic
1113981389 13:114280006-114280028 CTCTGCACACCTCTGAAGCCAGG - Intergenic
1119658831 14:76436417-76436439 CTCTGGAGCCCTCTGCAGCCTGG + Intronic
1119713198 14:76837892-76837914 TTCTGGCCCCCTCCAAACCAAGG - Exonic
1121674931 14:95744723-95744745 TCCCAGCCTCCTCTGAAGCCAGG - Intergenic
1121759696 14:96434691-96434713 TTCTGGACCCACCTGGAGCCTGG - Intronic
1121994175 14:98589058-98589080 CTGAGGCCCCCTCAGAAGCCGGG + Intergenic
1122244744 14:100394550-100394572 GTCTGGTCCCCTCTGATCCCAGG - Intronic
1122583171 14:102784509-102784531 TACTGGGCCCCTCTGATGCTTGG + Intronic
1122936056 14:104956776-104956798 TTCTGGGCCCCTCTGAAGGGAGG - Intronic
1123098121 14:105775993-105776015 TTCTGGCCCCCACTGGGCCCTGG + Intergenic
1123123070 14:105927006-105927028 TTCTGCCCCCAGCAGAAGCCCGG - Intronic
1125730757 15:41891662-41891684 ATCTGTCTCCCTTTGAAGCCAGG + Intronic
1125765230 15:42131098-42131120 TGTAGGCCCCCTCTGTAGCCAGG + Intergenic
1127536333 15:59893271-59893293 TTCTGTCCCCCTCTTCATCCAGG - Intergenic
1128251211 15:66165573-66165595 TTCTGGCCCCTCCTGATCCCTGG + Intronic
1129302801 15:74635748-74635770 TTTTGTCCCCCTCTGGAGCCTGG - Intronic
1129357029 15:74998041-74998063 CTCTGGCCTGATCTGAAGCCAGG + Intronic
1129521280 15:76187808-76187830 TTAGGGCCCAGTCTGAAGCCAGG + Intronic
1129664454 15:77571847-77571869 TTTGGCCCCCCACTGAAGCCAGG + Intergenic
1131075031 15:89490153-89490175 TTCTGGTGCCCACTGCAGCCTGG + Intronic
1133398955 16:5470750-5470772 GTCTGTCCGCCTCTGCAGCCTGG + Intergenic
1138593646 16:58017382-58017404 CTCTGTCCACCTCTGAAACCAGG - Exonic
1139514649 16:67446029-67446051 CTCTGGCCCACTCAGAAGCTAGG - Intronic
1140315473 16:73892137-73892159 GCCTGGCCCCCTCTGCAACCAGG - Intergenic
1141000185 16:80300487-80300509 TCCTGGCCCCTGCTGGAGCCAGG - Intergenic
1142021444 16:87785379-87785401 CTCTGGCCCCATCAGAAACCAGG - Intergenic
1142243761 16:88959042-88959064 CTCTGTTCCCCTCTGAATCCTGG - Intronic
1142472655 17:172004-172026 CTGTGGACCCCTCTGCAGCCTGG - Intronic
1144763714 17:17721878-17721900 TTCTGGCATTCCCTGAAGCCTGG - Intronic
1145003501 17:19321771-19321793 TTCTGGCCCCCTGTGGAGCCTGG - Intronic
1145219192 17:21074498-21074520 TGCTGGCCCCTGCTGGAGCCTGG + Intergenic
1146986082 17:37219486-37219508 TTATGGCCCCATCTGAAGTAGGG + Intronic
1148243387 17:46014400-46014422 TTCCAGCCCCTTCTGAAGTCTGG - Intronic
1149157292 17:53647353-53647375 TTCTGGACCCATCTGAAGCCTGG - Intergenic
1150617463 17:66783428-66783450 CTCTGGGCCCCACTGAAGGCTGG - Intronic
1151378785 17:73710506-73710528 TTCTGCCTCCCTCTGATGGCTGG - Intergenic
1151419288 17:73986810-73986832 TGCTGCCCCCCTCTGCATCCCGG - Intergenic
1152539544 17:80968004-80968026 TTCTGGCACCCACTGCAGCCTGG + Intergenic
1153141964 18:1983043-1983065 TTCTGTCCCCCTCTAATGCTGGG - Intergenic
1154020960 18:10663629-10663651 TTCTGGCCCACACTGAGGTCGGG - Intergenic
1156514373 18:37667793-37667815 TTCTGGACCCAGCTGAACCCTGG - Intergenic
1157019185 18:43758497-43758519 TTCTTGCCCCCTGTGAATTCAGG - Intergenic
1157580193 18:48769566-48769588 TGCTGGCCTCCTGTGATGCCAGG - Intronic
1158565772 18:58553096-58553118 TTCTGGCCACCACTGGAGCTAGG + Intronic
1161080978 19:2309989-2310011 TTCTGGACCTCTCTGGGGCCAGG - Intronic
1162385312 19:10357471-10357493 TTCTTCCCCACTCTGCAGCCTGG + Intronic
1163465232 19:17464119-17464141 TTCTGCCCCCCCTTGAATCCAGG + Intergenic
1163697010 19:18769097-18769119 TTCTTGCCTCCTAGGAAGCCTGG - Intronic
1165007733 19:32820176-32820198 TTCTGGGCCCCTCAGAAGACAGG + Intronic
1168111112 19:54191666-54191688 TTATGGTCCCTTCAGAAGCCAGG - Intronic
926408910 2:12581610-12581632 TTCTGGGCCCCACTCAAGGCTGG - Intergenic
926469352 2:13234293-13234315 CTCATGCCCACTCTGAAGCCAGG + Intergenic
927452502 2:23221177-23221199 TCCTGGGCCCCTCTGGACCCTGG + Intergenic
927783904 2:25959238-25959260 TTCGGGCCCCCTCAGTAACCAGG + Intronic
930864501 2:56109144-56109166 TTCTGGAGCCCTCAGAAGCTGGG - Intergenic
931284147 2:60818526-60818548 TTCTTTCCCCCTCAGCAGCCAGG - Intergenic
931516289 2:63052230-63052252 CTCTGGCCCTCTGCGAAGCCTGG + Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
934567457 2:95348428-95348450 TTCTTTCCCCATCTGGAGCCTGG + Intronic
934609436 2:95723608-95723630 ATCTGGTGCCCCCTGAAGCCTGG + Intergenic
935726151 2:106025911-106025933 AGCTGCCCCACTCTGAAGCCTGG + Intergenic
936380280 2:111979026-111979048 TTCTTCCCCCGTGTGAAGCCTGG + Intronic
937023821 2:118681252-118681274 TGCTGGCCCCATCTGTGGCCAGG + Intergenic
937491093 2:122368755-122368777 TTCTGCCCCCTTCTGGCGCCTGG + Intergenic
937504254 2:122518618-122518640 TACTGGCTCCTTCTGAAGGCAGG - Intergenic
938263644 2:129911705-129911727 TTCTGACCCCCACCGCAGCCGGG + Intergenic
942489591 2:176476185-176476207 TTCTGGGGCCCTGTGAAACCTGG + Intergenic
943251847 2:185532290-185532312 TTCTGAACCCCTCTGAAGTTAGG - Intergenic
944987271 2:205191795-205191817 GTCTGGCCCACTCTAAATCCTGG - Intronic
946167638 2:217875000-217875022 TCCTTGCCCCCTTTGAAGCTAGG + Intronic
947792071 2:232874075-232874097 TTCTGGGCCTCTCTCAAGCCTGG - Intronic
947888547 2:233595579-233595601 GACTTGCACCCTCTGAAGCCAGG - Intergenic
1169049945 20:2567202-2567224 TTCAGGCCTCCACTCAAGCCTGG - Intronic
1169266197 20:4168508-4168530 CTCTGGCCCCCTCCGAACACAGG - Intronic
1171031047 20:21676648-21676670 TTCTGTCATGCTCTGAAGCCTGG - Intergenic
1173189155 20:40863072-40863094 TTCTTCCCTCCTCTGCAGCCTGG + Intergenic
1173759390 20:45546342-45546364 TTCTGACCCTCTCTGAACCTTGG + Intronic
1173864922 20:46307640-46307662 TTCTGGTCCCCTCTGAGCCGGGG - Intronic
1176430123 21:6570172-6570194 TTCTGGCCTCCCCAGCAGCCTGG - Intergenic
1177386308 21:20413420-20413442 TTCTGGTCCTCTTAGAAGCCTGG + Intergenic
1178051720 21:28754897-28754919 TTCTTGCCTCTTCTAAAGCCTGG - Intergenic
1178275255 21:31231004-31231026 TTCTGGCCCCCTCTGAAGCCAGG + Intronic
1179705517 21:43177634-43177656 TTCTGGCCTCCCCAGCAGCCTGG - Intergenic
1182358847 22:29735034-29735056 TCCTGGCTCCCTCTCCAGCCTGG - Intronic
1182420821 22:30247762-30247784 TTCTGGCGTCTTCTGAGGCCAGG + Intergenic
1182864237 22:33588721-33588743 CTCTGACTCCCTCTTAAGCCAGG - Intronic
1183299858 22:37053508-37053530 CTCTGGCCTCCTAGGAAGCCAGG + Intronic
1184196336 22:42931542-42931564 TTGTGGAGCCCTCTGAACCCTGG - Intronic
1184506689 22:44907964-44907986 TTGTGGCCCCCTGGGAAGGCTGG + Intronic
1185017122 22:48351338-48351360 GTCTGACTCCCTCAGAAGCCTGG - Intergenic
1185126601 22:49014674-49014696 GTCTGGCCCCCTCTGAGGGTCGG + Intergenic
1185340545 22:50288969-50288991 TTCTGGGCACCTCTGATGGCCGG - Exonic
949930178 3:9072225-9072247 TTCTGCCCCTCTCTGCACCCAGG + Intronic
950452458 3:13073039-13073061 TTCTGGCTCCCTCTCCAGCGGGG + Intronic
951146112 3:19229479-19229501 GGCTTGCACCCTCTGAAGCCAGG + Intronic
951425935 3:22544992-22545014 CTCTGTCCCTCTCTGAAGTCTGG + Intergenic
953929892 3:47000629-47000651 TTGAGGGCCCTTCTGAAGCCTGG - Intronic
954361145 3:50123520-50123542 TTCCTGCCCCCTCAGGAGCCAGG - Intergenic
954363049 3:50132634-50132656 ATCTGGCACCATCTGCAGCCTGG - Intergenic
954678900 3:52330932-52330954 TTCTGGCTCCTTCTGCAGCACGG + Intronic
955089684 3:55737198-55737220 TTCTGGGCCCCACTAATGCCTGG + Intronic
955427293 3:58805362-58805384 TTCAGGCCCCTCCTGAGGCCTGG + Intronic
956180923 3:66517715-66517737 TTCTTGACCCCACTGAAACCAGG + Intergenic
956659210 3:71582599-71582621 TTTTACCCCCCTCTGAAGCTTGG - Intronic
956730195 3:72189442-72189464 ATCTGGACCCCACTGGAGCCAGG + Intergenic
958631134 3:96685399-96685421 TTCTGGACCCACCTGGAGCCTGG - Intergenic
959209093 3:103353448-103353470 TTCTGGACCTCTTAGAAGCCAGG - Intergenic
959581929 3:107991360-107991382 TTCTGCCACCCTCTGTGGCCTGG - Intergenic
960673241 3:120171731-120171753 TTCTGGCCTTCTGTGTAGCCAGG + Intronic
961651054 3:128416842-128416864 TGCTGGCCCCATCTGAGCCCTGG + Intergenic
961783664 3:129336575-129336597 TTCTGGTCCCCGCTGAACTCTGG + Intergenic
964314919 3:155433704-155433726 TTGTGGCTCACTCTGCAGCCAGG + Intronic
967014976 3:185473523-185473545 TTCTGGCCTGCACTGAAGGCAGG - Exonic
967185707 3:186942805-186942827 TTCTAGCCCTTTCTGAAGCTTGG - Intronic
967288506 3:187896855-187896877 CTCTAGCCCCCTCTGGAGCCGGG + Intergenic
968904681 4:3445782-3445804 TTGTGGCCCCCTCAGCAGCCCGG - Intronic
969286122 4:6202997-6203019 TCCCAGCCTCCTCTGAAGCCAGG - Intergenic
969890384 4:10254789-10254811 TTGTGGTCCCCTCTGAAGCATGG + Intergenic
973597373 4:52506399-52506421 TTCTGGCCTCCTTTGTATCCTGG - Intergenic
975992985 4:80279939-80279961 AGCTGGCACCCTCTGAAACCAGG - Intronic
979525472 4:121711780-121711802 TTCTGGCCCCCTGGGATTCCTGG - Intergenic
981337814 4:143586613-143586635 TTCTACCCACCGCTGAAGCCTGG - Intronic
983909886 4:173226057-173226079 TGCTGGCACTCTCTGCAGCCAGG + Intronic
984136497 4:175946724-175946746 CTCTGCCCACCTCTGTAGCCTGG - Intronic
985484726 5:141535-141557 TTCGGGGCCCCTCTAAACCCAGG + Intronic
986410693 5:7475758-7475780 TTCTGCCCTCCTCCAAAGCCTGG - Intronic
987663309 5:20905153-20905175 ACCTGGGCCCCTTTGAAGCCTGG + Intergenic
989086941 5:37685840-37685862 TTCTGGCCCCCAGTGACTCCTGG - Intronic
991205320 5:64042818-64042840 TTCTGGATCCATCTGAGGCCTGG + Intergenic
991703278 5:69334934-69334956 GTCTGGCTCCCTCTGGAGGCGGG + Intergenic
993231930 5:85247767-85247789 TTCTGGACCCCACTGAAAACTGG + Intergenic
997749091 5:136327452-136327474 TTCTTGCCCTCTCTAAAGACTGG - Intronic
999327268 5:150650995-150651017 TTCCTGCCCCCTCTGAGGCCTGG + Exonic
999401686 5:151269190-151269212 TTCTGGGCTCATTTGAAGCCTGG + Exonic
1000359096 5:160431364-160431386 TTCTTCCCCACTCTGAGGCCTGG + Intergenic
1002057297 5:176605841-176605863 TCCTGGCCCTCACTGGAGCCTGG - Intronic
1002494424 5:179602135-179602157 TGCTGGGCCCCTCTGAGGCCGGG - Intronic
1003181048 6:3792042-3792064 CTGTGGCCCACTCTGGAGCCTGG + Intergenic
1006730906 6:36235614-36235636 TTCTGGCCTCTACTGAAGCTGGG + Intergenic
1007372996 6:41439056-41439078 CTCTGGCCTCCTCTGTAGCTAGG - Intergenic
1007636414 6:43302434-43302456 TTCTGCCCACCCCAGAAGCCGGG + Intronic
1007687076 6:43673363-43673385 TCATGTACCCCTCTGAAGCCTGG - Intronic
1009973190 6:70646254-70646276 TTCTCCTTCCCTCTGAAGCCAGG - Intergenic
1011170939 6:84503817-84503839 GGCTTGCACCCTCTGAAGCCAGG - Intergenic
1013737789 6:113248283-113248305 TCCTGGCCCCCAGTGACGCCAGG + Intergenic
1014696074 6:124622868-124622890 TGCTGGCCTGCTCTGGAGCCTGG + Intronic
1014703271 6:124715522-124715544 TCCATGCCCCTTCTGAAGCCAGG + Intronic
1017717965 6:157225190-157225212 TCCTGGCTCGCTCTGCAGCCTGG - Intergenic
1019710590 7:2516556-2516578 TTCTGTCCCCATCTGAGTCCAGG - Intronic
1022522059 7:31014850-31014872 ATCTGGGTCCCTCTGAGGCCAGG - Intergenic
1023108834 7:36789769-36789791 TTCTGGCCTCTTTTGAAGCTTGG + Intergenic
1023685004 7:42724638-42724660 TTTGGGTCACCTCTGAAGCCTGG - Intergenic
1024124952 7:46284231-46284253 TTTTAGCCCCTTCTGCAGCCAGG - Intergenic
1024282790 7:47733319-47733341 TCCTGCCCTCCTCTGCAGCCTGG + Intronic
1024854344 7:53760215-53760237 TTCTTGCCCCCTGTGAATGCAGG - Intergenic
1032382683 7:131501615-131501637 TTCTGGCCTCCTGTGCAGCTTGG + Intronic
1032524692 7:132571179-132571201 TTCTGTCCCACTCCAAAGCCAGG - Intronic
1033039311 7:137903842-137903864 TTCTGGCCACCTTGGAAACCCGG - Intronic
1034421987 7:150995367-150995389 CTCCGGCCCCATCTGAGGCCAGG - Intronic
1034568183 7:151932587-151932609 TTCTGGCCACCTTTGGAGACTGG - Intergenic
1035231412 7:157468266-157468288 TTCTGGGCCCGTGTGAGGCCGGG + Intergenic
1038537457 8:28363743-28363765 TTCAGGCGCCGTCTGAAGACTGG - Intronic
1041694168 8:60718078-60718100 TTCTGTGCCACTCTGAAGACTGG - Intronic
1042477603 8:69266640-69266662 TCCGGGCTCCCTCTGAAGACTGG - Intergenic
1044395153 8:91702707-91702729 TTCTGGACCCATCTGGGGCCTGG - Intergenic
1044602477 8:94019615-94019637 TTCTTACCCTCTCTGAACCCTGG + Intergenic
1047153787 8:122294670-122294692 GGCTTGCACCCTCTGAAGCCAGG + Intergenic
1048357656 8:133666803-133666825 TTCTGGCTCCTTCTCCAGCCTGG + Intergenic
1048705994 8:137154490-137154512 GTCTTACACCCTCTGAAGCCAGG - Intergenic
1048720047 8:137312947-137312969 TGCTGGCCCACTCTACAGCCCGG - Intergenic
1048883387 8:138888445-138888467 CTCTGGCCCACTCTGGGGCCTGG - Intronic
1049855210 8:144857398-144857420 TTCTGGCCCCCCCAGAAGGTGGG - Intergenic
1049973562 9:841791-841813 CTCTGGCCCCCTCTCTCGCCTGG - Exonic
1051411323 9:16792571-16792593 TTTTGGCCCCTTCTGCAGACTGG - Intronic
1051592629 9:18791919-18791941 TTCTGCCCATGTCTGAAGCCTGG - Intronic
1056301810 9:85249777-85249799 TGCTGGTCTCCTCTGGAGCCTGG + Intergenic
1057281596 9:93716645-93716667 TTCTGGGCCCCACTGATACCAGG + Intergenic
1057423216 9:94928423-94928445 AGCTGGCCCCCTATGAGGCCCGG + Exonic
1057873578 9:98736056-98736078 TCCTGGCCTCCTCTGCATCCAGG + Exonic
1058537485 9:105977273-105977295 TGCTGGCCCTCTTGGAAGCCTGG - Intergenic
1058727165 9:107815193-107815215 TTCTGCCACCCTCAGGAGCCCGG + Intergenic
1059653054 9:116333455-116333477 TTTTGGCCACTACTGAAGCCTGG + Intronic
1060085444 9:120695878-120695900 TTCTGGCCTCCCCTGCAGCCAGG + Intronic
1060194852 9:121616944-121616966 CTCTGTCCCCCTATTAAGCCAGG - Intronic
1060228588 9:121811237-121811259 TTCTGGACCAAGCTGAAGCCTGG + Intergenic
1061714073 9:132507869-132507891 TTCAGGCCCTCTCTGAGGCCCGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062098828 9:134717404-134717426 TTCTTTCCCCTTCTGAAGCTGGG - Intronic
1062303341 9:135888134-135888156 TACTGGATCCCTCTGAACCCTGG + Intronic
1187097369 X:16162475-16162497 GGCTTGCACCCTCTGAAGCCAGG + Intergenic
1188067055 X:25675373-25675395 ATTTGGCACCCTCTGAAGCCAGG + Intergenic
1193049825 X:77087931-77087953 TTTTGTCCCCCTCTGAAGTCAGG - Intergenic
1193790356 X:85808864-85808886 TTCTGGCCCCCAGTGACCCCTGG - Intergenic
1194179624 X:90696173-90696195 TTCTGGACCCCACTGAAATCTGG + Intergenic
1194513448 X:94822477-94822499 TTCTGGACCCCACTCAAGACTGG + Intergenic
1195942079 X:110175129-110175151 TTTTGGCCCTCTTTGAAGGCAGG + Exonic
1198226130 X:134647494-134647516 CACAGGCACCCTCTGAAGCCTGG - Intronic
1200526286 Y:4278342-4278364 TTCTGGACCCCACTGAAATCTGG + Intergenic