ID: 1178275858

View in Genome Browser
Species Human (GRCh38)
Location 21:31236327-31236349
Sequence CTAATCCATGCCAAAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178275852_1178275858 15 Left 1178275852 21:31236289-31236311 CCTGGGGCTCCACATATCCTAGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1178275858 21:31236327-31236349 CTAATCCATGCCAAAATCAAAGG 0: 1
1: 0
2: 1
3: 9
4: 155
1178275854_1178275858 6 Left 1178275854 21:31236298-31236320 CCACATATCCTAGAGTTGGCCCT 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1178275858 21:31236327-31236349 CTAATCCATGCCAAAATCAAAGG 0: 1
1: 0
2: 1
3: 9
4: 155
1178275855_1178275858 -2 Left 1178275855 21:31236306-31236328 CCTAGAGTTGGCCCTTCACAACT 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1178275858 21:31236327-31236349 CTAATCCATGCCAAAATCAAAGG 0: 1
1: 0
2: 1
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178275858 Original CRISPR CTAATCCATGCCAAAATCAA AGG Intronic
902094727 1:13933574-13933596 CTAAGCCAGGCAAAAAACAAAGG - Intergenic
904602641 1:31682107-31682129 CTAATTGCAGCCAAAATCAAAGG - Intronic
908213574 1:61926987-61927009 ATAAAACATGCCAAACTCAACGG - Intronic
909823389 1:80094805-80094827 ATAAAACATGCCAAAATCTATGG - Intergenic
911542705 1:99177814-99177836 GTAATCAAAGCCAAAATCGATGG + Intergenic
912358564 1:109075702-109075724 CAAATACAGACCAAAATCAAGGG + Intronic
913974563 1:143444633-143444655 CTAATAAATGCTAAAACCAATGG + Intergenic
914068953 1:144270249-144270271 CTAATAAATGCTAAAACCAATGG + Intergenic
914110202 1:144696105-144696127 CTAATAAATGCTAAAACCAATGG - Intergenic
917922451 1:179762075-179762097 CTGCTTCCTGCCAAAATCAATGG - Intronic
919492221 1:198218906-198218928 CATATCCATGCCAGAATCTATGG - Intronic
923497649 1:234539155-234539177 CCAAACCATGGCAAACTCAAGGG - Intergenic
924785053 1:247187651-247187673 TTCATACATTCCAAAATCAAAGG + Intergenic
1063743273 10:8850248-8850270 CTAGTCCATGCAAAATTCACGGG + Intergenic
1063853475 10:10220423-10220445 CTACTCAATGCCAAAATGAGAGG + Intergenic
1064673505 10:17738972-17738994 ATATTCCAAGTCAAAATCAAAGG + Intergenic
1064695990 10:17965736-17965758 ATAAACTATGCCAAAAACAAAGG + Intronic
1067929901 10:50550265-50550287 CTAATCTATGCAAAAATCCTTGG + Intronic
1070547151 10:77461588-77461610 CTAGTCCAGCCCTAAATCAAGGG - Intronic
1075986725 10:126794171-126794193 CACATCCATGCCAACATCTATGG - Intergenic
1076091287 10:127688361-127688383 CTAAGCCATGCCAAGATGATAGG + Intergenic
1077988594 11:7380810-7380832 CTAATGCATGTGAAAATAAAAGG - Intronic
1079704915 11:23602819-23602841 CTAATCTATGTAAAAATGAAAGG - Intergenic
1082829561 11:57605677-57605699 CTATTCCGTGCCAAAATTAAGGG + Intronic
1088066248 11:105723590-105723612 CTAATTCATGCCAAAATTAAGGG - Intronic
1090963679 11:131579898-131579920 TTGATGCATGCCAAAATCATGGG - Intronic
1093820504 12:23611730-23611752 CTAATCCATGCCTGAAGTAAAGG - Intronic
1094285711 12:28790977-28790999 ATAATCCATGCTAAAATATATGG + Intergenic
1095486535 12:42690431-42690453 TTAATCCATTCAACAATCAAAGG + Intergenic
1099190637 12:79558554-79558576 CTACTCGTTGCCAAAATTAAAGG - Intergenic
1101781449 12:107842045-107842067 ATACTCATTGCCAAAATCAAAGG + Intergenic
1103494118 12:121348215-121348237 TTAATCTTTGCCAAAAACAAGGG - Intronic
1106648903 13:31667148-31667170 CTAATGGATGCTAAAATTAATGG + Intergenic
1107420810 13:40244756-40244778 GTGATCCATGCCAATATCAGAGG + Intergenic
1109035894 13:57259703-57259725 CCAAAGCATGCCAAAATCATGGG - Intergenic
1109767387 13:66920808-66920830 ATACTCCTTTCCAAAATCAAAGG + Intronic
1110726081 13:78825693-78825715 CTAATAAATGGCACAATCAAGGG - Intergenic
1111852177 13:93589484-93589506 TTAATCCATGCTCAAATCACAGG + Intronic
1112527867 13:100169457-100169479 CTAATCCTTACATAAATCAAGGG - Intronic
1113163705 13:107413171-107413193 CTATTTCATGGAAAAATCAAAGG - Intronic
1113289019 13:108884975-108884997 CTCATCCATTCTAAACTCAAAGG + Intronic
1114858969 14:26491506-26491528 ATAATCCATTCCCAAATCCAAGG + Intronic
1115830474 14:37334419-37334441 CTTATCCATACGCAAATCAATGG + Intronic
1116753691 14:48919199-48919221 CACATCCATGCCAACATCTATGG - Intergenic
1117065316 14:52008081-52008103 CTAATGCAGCCCAAACTCAAGGG - Exonic
1117856939 14:60044472-60044494 ATAAACCATACCAAAATCTATGG - Intronic
1120317220 14:82910742-82910764 CTATTTCAGGACAAAATCAAAGG + Intergenic
1121631532 14:95424500-95424522 CTTATCCATTACAAAAGCAATGG + Intronic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1122925718 14:104898606-104898628 CTTTTCCATGCAAAAATTAATGG + Intergenic
1124080787 15:26493183-26493205 CTAACAGATGCCAAAATCTATGG + Intergenic
1124794919 15:32768607-32768629 TTAATCCATGCCAAATTCTTTGG + Exonic
1126573536 15:50175696-50175718 CACATCCATGCCAACATCTACGG - Intronic
1127741819 15:61915289-61915311 CTAATATATGCCAAATTCAATGG + Intronic
1132039744 15:98515189-98515211 CAAATCCAAGGCAATATCAAAGG + Intergenic
1138751036 16:59421246-59421268 CACATCCATGCCAACATCTATGG + Intergenic
1139204944 16:65019014-65019036 CTAATTCATGTCAAAATTATAGG + Intronic
1139416579 16:66816156-66816178 CTAAGCCATAACAAAACCAAAGG + Intronic
1139774466 16:69307312-69307334 TTGATCCATGCCAACATGAAAGG + Exonic
1140289091 16:73633658-73633680 CCAATCCACGCCACAATCACAGG - Intergenic
1140331742 16:74064293-74064315 CTAATTCATGACTAACTCAAGGG + Intergenic
1143703965 17:8683653-8683675 CTAAGCCTTGCCAAAAGAAAAGG + Intergenic
1145770958 17:27492751-27492773 CTATTCCAAGCCAACATCTATGG - Intronic
1148814132 17:50314463-50314485 TGAATTCATTCCAAAATCAAAGG - Intergenic
1150184379 17:63164650-63164672 GTAATCCAGTCCAAAACCAAAGG + Intronic
1154033962 18:10780349-10780371 CGTAGCCATGCCAAAGTCAATGG - Intronic
1157900936 18:51516578-51516600 CAAAACCAGGCCAAATTCAAAGG - Intergenic
1157906774 18:51576307-51576329 CTGACCCATGGAAAAATCAATGG - Intergenic
1162441076 19:10692364-10692386 CTAACCCATCCCAGAATAAATGG + Exonic
1166208037 19:41285799-41285821 CTAATCCCTGCAAAGTTCAAGGG - Intronic
926643882 2:15267317-15267339 CTTATTCAGGCCAGAATCAAAGG + Intronic
930792095 2:55343792-55343814 CTAATCCTTGCCAATAAAAAAGG - Exonic
931375360 2:61702862-61702884 CTGATCCCGGCCAAGATCAATGG - Intergenic
932029239 2:68166196-68166218 CTAATCCCTGCAATATTCAAGGG - Intronic
933824114 2:86142894-86142916 CCAATATATCCCAAAATCAAAGG + Intergenic
934179266 2:89605608-89605630 CTAATAAATGCTAAAACCAATGG + Intergenic
934289553 2:91679871-91679893 CTAATAAATGCTAAAACCAATGG + Intergenic
934600948 2:95658032-95658054 CTCATCAATGCCAAACTCAATGG + Intergenic
938417177 2:131113242-131113264 CTCATCCATACAAAAATCAGCGG - Intronic
939348665 2:141002457-141002479 CTTATAAATGCCAAAATCCATGG + Intronic
939354706 2:141086215-141086237 CTAATACATGCTGAAATCAATGG - Intronic
941318122 2:164020088-164020110 CGCATCCATGCCAACATCTACGG + Intergenic
943305754 2:186260432-186260454 CTAATCCATGGGAAAACAAAAGG - Intergenic
944793366 2:203156287-203156309 CTAAGCCATGGCAATAGCAAAGG - Intronic
945319236 2:208402591-208402613 CTAATCCATCTCCAAATTAAAGG + Intronic
1169656049 20:7924163-7924185 CTAAACCAAACCAAAATCATGGG - Intronic
1170327534 20:15173274-15173296 CTCATCCAAGCAAATATCAAAGG - Intronic
1171139305 20:22727459-22727481 CTACTGCATGCCCTAATCAATGG - Intergenic
1172751719 20:37256131-37256153 TGACTCCATGCCAAAAACAAAGG - Intronic
1174445549 20:50588389-50588411 CTGATCCATCCCAGAATGAATGG + Intronic
1174464405 20:50706141-50706163 CTAATACATGCTACAATGAATGG + Intergenic
1174922198 20:54715943-54715965 GTAATCCCTCCCAGAATCAAAGG - Intergenic
1177289637 21:19094554-19094576 ATAATCCATGGCAAAAGCCATGG + Intergenic
1178275858 21:31236327-31236349 CTAATCCATGCCAAAATCAAAGG + Intronic
1185180690 22:49359502-49359524 CAAATACATGCCAAAATATAAGG + Intergenic
952515631 3:34102165-34102187 CTAAGACAGGCCAAAAGCAAGGG - Intergenic
953188427 3:40660604-40660626 ATAATCCAGGCCTAAATCTAAGG + Intergenic
953548779 3:43884600-43884622 CTAATCCATACCAACCTCATTGG + Intergenic
954970962 3:54651560-54651582 CTAAGCCATTCCATGATCAAGGG - Intronic
955991882 3:64636611-64636633 ACAAACCATGCAAAAATCAATGG - Intronic
957849774 3:85792274-85792296 CAAATATATGCCAAAATGAAGGG + Intronic
960009368 3:112816720-112816742 ATAATCAATTCCATAATCAATGG + Intronic
960905580 3:122597805-122597827 CCAAGCAATGCCAAAATCCATGG + Intronic
965823401 3:172707414-172707436 CTAATCCATGCTAATGTAAAAGG + Intronic
969649340 4:8454835-8454857 CTAAGCCATGCTGAGATCAAGGG - Intronic
969830007 4:9788010-9788032 CTAATAAATGCTAAAACCAATGG - Intronic
973083813 4:46029349-46029371 CACATCCATGCCAACATCTACGG - Intergenic
974151852 4:58020352-58020374 CCACTCCATAGCAAAATCAAAGG - Intergenic
974475330 4:62371879-62371901 ATGAGTCATGCCAAAATCAAAGG - Intergenic
976358056 4:84143953-84143975 CTAATGAATGCCAAAATTAGTGG + Intergenic
977080793 4:92524941-92524963 TGAATCCATGCTAAAACCAAGGG - Intronic
979025352 4:115566124-115566146 CTAATCCATTGAAAAATTAATGG + Intergenic
980284538 4:130766009-130766031 CTAATCCATGTCGAAAGGAAGGG - Intergenic
981867293 4:149438243-149438265 CTAATACAGGCTAAAAACAATGG + Intergenic
983802751 4:171955464-171955486 CTCATGCATGCCAAAATCTAAGG + Intronic
985014927 4:185623835-185623857 CAAATCCATGCCAAATTTAGGGG - Exonic
988650262 5:33141183-33141205 GTAATACATGCCAAAGTGAAGGG + Intergenic
991111238 5:62902036-62902058 CTAATTCATGCCAAGATGATTGG - Intergenic
991358923 5:65799961-65799983 CTAATCTATCCCTAAATCCAGGG - Intronic
994263851 5:97691441-97691463 GTTATCCATGCTAAAATCAGAGG - Intergenic
999843947 5:155457948-155457970 GCCATCCATGCCAAAATAAATGG - Intergenic
1000724201 5:164748397-164748419 TTAATCTATTACAAAATCAAAGG + Intergenic
1003217321 6:4126295-4126317 CTACTGCATGCCAAACTCTATGG + Intronic
1004652978 6:17630036-17630058 ATAATCCCTGATAAAATCAAAGG + Intronic
1009652629 6:66495381-66495403 CTCATGCATACCAAAATCCATGG - Intergenic
1009674297 6:66796955-66796977 CTAATCCTAGCCAAAATAAATGG - Intergenic
1010017073 6:71117310-71117332 CTAATCGTTTACAAAATCAAAGG - Intergenic
1011322516 6:86112461-86112483 ATATGACATGCCAAAATCAATGG - Intergenic
1013373721 6:109493744-109493766 ATAATCCATGCCATAAAGAAGGG - Intronic
1013759888 6:113505639-113505661 CTAATGCATGCCAAAATCTGAGG + Intergenic
1017610045 6:156175914-156175936 TTAAATCATGCAAAAATCAAGGG + Intergenic
1020601321 7:10277752-10277774 ATAATCCCTTCTAAAATCAAGGG + Intergenic
1022289105 7:28984167-28984189 CTAAGCCAGGACAAAATTAATGG - Intergenic
1024800043 7:53066363-53066385 CTAATTCATTGCAAAATAAAAGG - Intergenic
1026226053 7:68442178-68442200 CTAACCCTTGCCAAAATTATAGG + Intergenic
1030593794 7:111511753-111511775 CTAATCCAGTCAAACATCAAAGG + Intronic
1032944950 7:136839671-136839693 GTAATCCATCCCAAAATAAAAGG + Intergenic
1033995624 7:147343026-147343048 GTAATCAATGGGAAAATCAAAGG - Intronic
1036800888 8:11789998-11790020 CTAAGCGATGCCTAAATCAAAGG + Intergenic
1039340047 8:36637758-36637780 CTACTGCATCCCAAAAACAATGG - Intergenic
1042983959 8:74563019-74563041 CAAATCCATGTCAAAAACCAAGG - Intergenic
1043489193 8:80731174-80731196 ATAATCCATACCAAAATTTAGGG + Intronic
1044162744 8:88940670-88940692 CTAATCCAGGCAAAAACAAATGG - Intergenic
1045439544 8:102195932-102195954 CTGAACCATGCCCAAATCCATGG + Intergenic
1045828618 8:106430932-106430954 CTAAGCCAGCCCAAATTCAAGGG - Intronic
1046790353 8:118315516-118315538 CTAATTCATGACAGAATCCATGG - Intronic
1047399304 8:124532637-124532659 CTAGAGCATGCCAAAATCATGGG + Intronic
1050905839 9:11004315-11004337 CTTATCCATGCCCTCATCAAGGG - Intergenic
1053723918 9:40976858-40976880 CTAATCGTCGCCAAAATGAAGGG - Intergenic
1054342046 9:63875141-63875163 CTAATCGTCGCCAAAATGAAGGG + Intergenic
1185832273 X:3313783-3313805 CTCCACCATGCCAAATTCAATGG + Intronic
1186321779 X:8435330-8435352 CAAATATATGCCAAAATCATAGG - Intergenic
1186721272 X:12306967-12306989 CCAAGCCATGGCAAAAACAAAGG + Intronic
1188293805 X:28420325-28420347 ATATTCCATGCAAAAATAAATGG + Intergenic
1192499868 X:71643568-71643590 CACATCCATGCCAACATCTATGG + Intergenic
1193932830 X:87578039-87578061 CTAATTCATTGCAAAATAAATGG + Intronic
1195486905 X:105419231-105419253 ATAATACATGCCAAACTCTATGG - Intronic
1196172070 X:112600014-112600036 CCAATGGATGCTAAAATCAATGG + Intergenic
1197443170 X:126514723-126514745 TTAATTCATTCCAAGATCAAAGG + Intergenic
1198387816 X:136146319-136146341 CCACTTCATTCCAAAATCAATGG - Intergenic
1198388433 X:136148982-136149004 CTATTCCAAACCCAAATCAAAGG - Intronic
1198527538 X:137517086-137517108 CTTCTCCATGCCAATATCTAAGG + Intergenic
1199229634 X:145422309-145422331 CTATTCTATACAAAAATCAAGGG - Intergenic
1201180452 Y:11337990-11338012 CTAATGAATTCCAAAATTAAAGG - Intergenic
1201243753 Y:11983259-11983281 CTCCACCATGCCAAATTCAATGG - Intergenic
1201904227 Y:19073473-19073495 CAAAGCCATGCCAAAAACTATGG + Intergenic