ID: 1178277574

View in Genome Browser
Species Human (GRCh38)
Location 21:31252885-31252907
Sequence CTTTGAAAGGGCAAGGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1377
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 1305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178277574_1178277580 -10 Left 1178277574 21:31252885-31252907 CCAATTACCTTGCCCTTTCAAAG 0: 1
1: 0
2: 3
3: 68
4: 1305
Right 1178277580 21:31252898-31252920 CCTTTCAAAGCTGGGATGCTAGG 0: 1
1: 0
2: 1
3: 18
4: 213
1178277574_1178277582 -1 Left 1178277574 21:31252885-31252907 CCAATTACCTTGCCCTTTCAAAG 0: 1
1: 0
2: 3
3: 68
4: 1305
Right 1178277582 21:31252907-31252929 GCTGGGATGCTAGGAGCCTTGGG 0: 1
1: 0
2: 2
3: 25
4: 269
1178277574_1178277585 20 Left 1178277574 21:31252885-31252907 CCAATTACCTTGCCCTTTCAAAG 0: 1
1: 0
2: 3
3: 68
4: 1305
Right 1178277585 21:31252928-31252950 GGCAGGCTACTTGCTGCCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 184
1178277574_1178277583 3 Left 1178277574 21:31252885-31252907 CCAATTACCTTGCCCTTTCAAAG 0: 1
1: 0
2: 3
3: 68
4: 1305
Right 1178277583 21:31252911-31252933 GGATGCTAGGAGCCTTGGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 237
1178277574_1178277581 -2 Left 1178277574 21:31252885-31252907 CCAATTACCTTGCCCTTTCAAAG 0: 1
1: 0
2: 3
3: 68
4: 1305
Right 1178277581 21:31252906-31252928 AGCTGGGATGCTAGGAGCCTTGG 0: 1
1: 0
2: 5
3: 89
4: 440
1178277574_1178277586 21 Left 1178277574 21:31252885-31252907 CCAATTACCTTGCCCTTTCAAAG 0: 1
1: 0
2: 3
3: 68
4: 1305
Right 1178277586 21:31252929-31252951 GCAGGCTACTTGCTGCCCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178277574 Original CRISPR CTTTGAAAGGGCAAGGTAAT TGG (reversed) Intronic
900860848 1:5229042-5229064 CTTTGGGAGGCCAAGGTGATTGG + Intergenic
901463824 1:9407727-9407749 CTTTGACAGGCCAAGGCAAGAGG + Intergenic
901476303 1:9492100-9492122 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
901581799 1:10250580-10250602 CTTTGGGAGGGCAAGGAAAGAGG + Intronic
901620357 1:10580466-10580488 CTTTGAAAGGTCAAGGCAGGTGG - Intronic
901689405 1:10962874-10962896 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
901750113 1:11401309-11401331 CTTTGAAAGGCCAAGGCAGGCGG - Intergenic
901778487 1:11576803-11576825 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
902167837 1:14586781-14586803 CTTTGAGAGGCCAAGGTACGAGG - Intergenic
902433378 1:16380848-16380870 CTTTGGAAGGCCAAGGCAAGTGG - Intronic
902529552 1:17081867-17081889 CTTTGGGAGGCCAAGGTAAGTGG + Intronic
902864069 1:19266555-19266577 CTTTGAGAGGCCAAGGCAGTAGG - Intergenic
903208892 1:21804304-21804326 CTTTGGAAGGGCAAGGTAGGAGG - Intergenic
903272204 1:22196716-22196738 CTTTGGAAGGGCAAGGCAAGAGG - Intergenic
903714012 1:25349696-25349718 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
903725211 1:25437398-25437420 CTTTGAGAGGTCAAGGTGAGTGG - Intronic
903777525 1:25802231-25802253 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
903841962 1:26249323-26249345 CTTTGAGAGGCCAAGGTGAGTGG - Intronic
903893741 1:26588457-26588479 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
903955798 1:27024699-27024721 CTTTGGGAGGCCAAGGTAAGTGG - Intergenic
903999061 1:27327848-27327870 CTTTGGAAGGCCAAGGCAGTTGG - Intronic
904064867 1:27741635-27741657 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
904119156 1:28184881-28184903 CTTTGAAAGGCCGAGGTAGGTGG - Intronic
904351587 1:29910587-29910609 CTATAAAAGGGGATGGTAATAGG + Intergenic
904506615 1:30961264-30961286 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
904550946 1:31317266-31317288 CTTTGAAAGGGCGAGGCAGGTGG - Intronic
904656161 1:32049297-32049319 CTTTGGAAGGCCAAGGTAGGCGG - Intronic
904660593 1:32081502-32081524 CTTTGGAAGGCCAAGGTGAATGG + Intronic
904728180 1:32566268-32566290 CTTTGGGAGGCCAAGGTAGTTGG + Intronic
904765523 1:32843694-32843716 CTTTGAGAGGCCAAGGTGGTCGG - Intronic
904776344 1:32909781-32909803 CTATGAAAGGCCAAGGAAAGAGG - Intergenic
904812788 1:33174425-33174447 CTTTGAGAGGTCAAGGCAAGAGG - Intronic
904830565 1:33303862-33303884 CTTTGAGAGGCCAAGGCAAGTGG + Intergenic
904993514 1:34613086-34613108 CTTTGGAAGGCCAAGGTAGGCGG + Intergenic
905073238 1:35246463-35246485 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
905116281 1:35643531-35643553 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
905120392 1:35677375-35677397 CTTTGGAAGGCCGAGGCAATAGG + Intergenic
905124192 1:35705861-35705883 CTTTGGGAGGCCAAGGTAGTAGG + Intergenic
905153411 1:35951630-35951652 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
905467405 1:38165824-38165846 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
905679588 1:39859007-39859029 CTTTGAAAGGCCAAGGCAGGCGG + Intronic
905685589 1:39905197-39905219 CTTTGAGAGGCCAAGGTGAGAGG - Intergenic
906165154 1:43680625-43680647 GCTGGAAAGGGCAAGGAAATGGG - Intronic
906229472 1:44148974-44148996 CTCTCAAAGGGTGAGGTAATAGG - Intergenic
906362110 1:45170670-45170692 CTTTGGAAGGCCAAGGCAAGAGG - Intronic
906412290 1:45588345-45588367 CTTTGGAAAGGCAAGGTGAGTGG - Intronic
906450431 1:45941499-45941521 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
906572370 1:46854463-46854485 CTTTGAAAGGCCAAGGCAGATGG + Intergenic
906977916 1:50595295-50595317 CTTTGAGAGGCCAAGGTGAGTGG - Intronic
907179969 1:52560955-52560977 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
907200824 1:52725680-52725702 CTTTGGAAGGCCAAGGCAAGCGG + Intergenic
907302557 1:53497680-53497702 CTTTGGAAGGCCAAGGCAAGTGG - Intergenic
908067349 1:60421279-60421301 TTTTAAAAAGGCAAGGAAATAGG + Intergenic
908368572 1:63455551-63455573 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
908995900 1:70153736-70153758 CTTTGGAAGGCCAAGGCAAGTGG + Intronic
909197357 1:72644738-72644760 CCTTTAAAGGGTATGGTAATTGG - Intergenic
909306745 1:74090642-74090664 CTTTGAAAGGCCAATGTAGGAGG + Intronic
909589212 1:77327141-77327163 CTTTGAAAGGCCAAGGTGGCAGG + Intronic
910558801 1:88567267-88567289 CTTTGGGAGGCCAAGGTAGTCGG + Intergenic
910578643 1:88796656-88796678 TTTTGTAAGGGAAAGGTAGTAGG - Intronic
910594902 1:88969899-88969921 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
910595778 1:88978896-88978918 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
910611042 1:89142492-89142514 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
910937740 1:92499429-92499451 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
910946876 1:92602648-92602670 CTTTGAGAGGCCAAGGTCAGGGG - Intronic
910968472 1:92831196-92831218 CTTTGAAAGGGTAAAGAAAGAGG - Intergenic
910993213 1:93077279-93077301 CTTTGAAAGGCCAAGGTAGAAGG - Intergenic
911103683 1:94113615-94113637 ATTTGCAAGGGCAAGGTAATGGG - Intronic
911534794 1:99087839-99087861 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
911733513 1:101313205-101313227 TTTTGGAAGGCCAAGGTAAGAGG - Intergenic
911785830 1:101945702-101945724 CTTTGAAAGGCCAAGGTAGGAGG + Intronic
912074438 1:105854772-105854794 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
912351286 1:109016157-109016179 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
912538850 1:110396909-110396931 CTTTGAGAGGCCAAGGTGAGTGG + Intergenic
912672174 1:111640714-111640736 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
912971566 1:114288686-114288708 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
913301405 1:117373735-117373757 CTTTGGGAGGCCAAGGTAAAAGG - Intronic
914065200 1:144240548-144240570 CTTTGGGAGGCCAAGGTAAGCGG - Intergenic
914113951 1:144725806-144725828 CTTTGGGAGGCCAAGGTAAGCGG + Intergenic
914325476 1:146611191-146611213 CTTTGAGAGGACAAGGTAGGAGG - Intergenic
914765300 1:150632059-150632081 CTTTGAATGGTCAAGGTGAGAGG + Intergenic
914778822 1:150764479-150764501 CTTTGGAAGGCCAAGGTGAGCGG - Intronic
914964627 1:152243827-152243849 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
915113617 1:153581247-153581269 CTTTGAGAGGCCAAGGTCAGTGG - Intergenic
915223930 1:154397591-154397613 CTTTGAGAGGCCAAGGCAAGCGG - Intergenic
915384188 1:155474452-155474474 CTTTGGGAGGGCAAGGTAGGAGG + Intronic
915390145 1:155535535-155535557 CTTTGGGAGGCCAAGGCAATAGG + Intronic
915407249 1:155670054-155670076 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
915419996 1:155772785-155772807 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
915448310 1:155987492-155987514 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
915478804 1:156170967-156170989 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
915492958 1:156261642-156261664 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
916047911 1:161014458-161014480 TTTTGAAAGGCCAAGGCAAAAGG + Intronic
916761473 1:167821365-167821387 CATTGAAAGGGCAAGTAAAGCGG - Intronic
917077949 1:171225580-171225602 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
917100845 1:171443544-171443566 CTTTGGGAGGCCAAGGTAATAGG + Intergenic
917388632 1:174506863-174506885 CTTTGAAAGGCCAATGTGGTTGG + Intronic
917412525 1:174774634-174774656 CTTTGGCAGGGCAAGGCAAGCGG + Intronic
917566986 1:176222968-176222990 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
917945459 1:179965867-179965889 CTTTGGAAGGCCAAGGAAAGTGG - Intronic
917947300 1:179988051-179988073 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
917994563 1:180421916-180421938 TTTAGAAAGGTCAAGATAATAGG - Intronic
918082052 1:181215263-181215285 CTTTGAGAGGCCAAGGTGAGCGG - Intergenic
918328098 1:183429507-183429529 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
918427531 1:184425715-184425737 GCTTGAAAGGGCAAGGTCAGAGG + Intronic
918453352 1:184682678-184682700 CTTTGAGAGGCCAAGGTGAGTGG - Intergenic
918539631 1:185616039-185616061 TTTTGAAAGGCCTAGGTAAGAGG + Intergenic
919540042 1:198834892-198834914 CTTTGAAAGGCCAAAGTAGCAGG + Intergenic
919590728 1:199498662-199498684 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
919598285 1:199591471-199591493 CTTTGGAAGGCCAAGGTGAGCGG + Intergenic
919731212 1:200914692-200914714 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
919971345 1:202581463-202581485 CTTTGAAGGGGGAAGATAAGTGG - Exonic
920360722 1:205414337-205414359 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
920452650 1:206071601-206071623 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
920502397 1:206493542-206493564 CTTTGAGAGGCCAAGGTGAGCGG + Intronic
920585151 1:207152018-207152040 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
920784368 1:209026680-209026702 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921400197 1:214713646-214713668 CTTTGGGAGGCCAAGGTAAGGGG - Intergenic
921448845 1:215278959-215278981 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
921572620 1:216797131-216797153 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
921874989 1:220185643-220185665 CTTTAAAAAGTCAAGGTAATAGG - Exonic
921961760 1:221042743-221042765 CTTTGAAAGGCCAAGGTGAGAGG - Intergenic
922229352 1:223672313-223672335 CTTTGAGAGGCCAACGTAAAAGG + Intergenic
922321482 1:224491996-224492018 CTTTGAGAGGCCAAGATAAGAGG - Intronic
922519697 1:226238385-226238407 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
922549956 1:226487461-226487483 CTTTGAGAGGCCAAGGTCAGCGG + Intergenic
922690932 1:227690329-227690351 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
922728290 1:227936433-227936455 CTTTGAAAGGCCAAGGTAGGTGG - Intronic
922844795 1:228676212-228676234 CTTTGGAAGGTCAAGGTGAAAGG - Intergenic
922953920 1:229583145-229583167 CTTTGGGAGGGCAAGGTGAGTGG - Intergenic
923135671 1:231116363-231116385 CTTTGAAAGTCCAAGGTGTTAGG + Intergenic
923739878 1:236645563-236645585 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
923969521 1:239184122-239184144 CTTTGGGAGGGCAAGGCAAGAGG - Intergenic
924321933 1:242859402-242859424 CTTTGAAAGGGCAAGGCAGGTGG + Intergenic
924519698 1:244795346-244795368 CTTTGAGAGGCCAAGGTGAGAGG - Intergenic
924757388 1:246953677-246953699 CTTTGAGAGGACAAGGTAGGTGG + Intronic
1063002235 10:1935351-1935373 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1063154877 10:3369651-3369673 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1063217841 10:3939836-3939858 CTTTGAAAGGCCAGGGTGAGAGG - Intergenic
1063677185 10:8151190-8151212 CTTTGGGAGGGCAAGGTGAGAGG - Intergenic
1063714000 10:8509343-8509365 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
1064138651 10:12771788-12771810 CTTTGAGAGGCCAAGGTGGTTGG + Intronic
1064192667 10:13221223-13221245 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1064196741 10:13249906-13249928 CTTTGAAAGGCCGAGGTAGGCGG + Intergenic
1064386916 10:14903241-14903263 CTTTGAAAGGACATGATAATGGG + Intronic
1064447468 10:15408330-15408352 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1064532267 10:16322553-16322575 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
1064598129 10:16966690-16966712 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1064706468 10:18077552-18077574 CTTTGAGAGGCCAAGGTGAGTGG + Intergenic
1064734769 10:18370541-18370563 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1064986580 10:21216527-21216549 CTTTGGGAGGGCAAGGTAGGCGG + Intergenic
1065031141 10:21587154-21587176 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1065352794 10:24810673-24810695 CTTTGGAAGGCCAAGGCAAGTGG - Intergenic
1065386535 10:25139184-25139206 CTTTGAGAGGTCAAGGTGAAAGG - Intergenic
1065444254 10:25781203-25781225 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1065926757 10:30441398-30441420 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1066118323 10:32259735-32259757 CTTTGAGAGGGCAAGGTGGGAGG - Intergenic
1066186504 10:33014610-33014632 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
1066298459 10:34076200-34076222 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1067124045 10:43500251-43500273 CTTTGGAAGGGCTAGGTGAAAGG - Intergenic
1067759261 10:49030925-49030947 CTTTGAAAGTTCCAGGTATTAGG - Intronic
1067936917 10:50620938-50620960 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
1068062773 10:52090054-52090076 CTTTGAGAGGGCAAGGCAGGTGG - Intronic
1068139554 10:52988387-52988409 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1068401167 10:56529392-56529414 CTTTGGAAGGCCAAGGTAGCAGG - Intergenic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1068677053 10:59779164-59779186 CTTTGGAAGGTCAAGGCAAATGG + Intergenic
1069120955 10:64568196-64568218 CTTTGGAAGGTCAAGATAAGAGG - Intergenic
1069432250 10:68348260-68348282 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
1069871004 10:71532973-71532995 CTTTGAGAGGGCAAGGCGAGTGG - Intronic
1070004995 10:72415257-72415279 CTTTGGGAGGCCAAGGTAGTTGG - Intronic
1070040475 10:72773138-72773160 CTTTGAAAGGCTAAGGTAGGAGG - Intronic
1070093157 10:73309548-73309570 CTTTGAAAGGCCAAGGCGAGAGG - Intronic
1070405607 10:76091928-76091950 CTTTGAAAGGCCAAGGCACCAGG - Intronic
1070688748 10:78509340-78509362 CTTTGTAAGGCAGAGGTAATGGG - Intergenic
1071037666 10:81266578-81266600 CTTTGAGAGGCCAAGGCAAAAGG - Intergenic
1071153289 10:82661513-82661535 CTATGAAATGGCACAGTAATAGG - Intronic
1071379864 10:85047689-85047711 CTTTGAAAGTGCAAGCTCTTTGG - Intergenic
1071428900 10:85588532-85588554 CTTTGAAAAGGAATGGTAAGAGG - Intergenic
1071672247 10:87619371-87619393 CTTTGGGAGGGCAAGGTAAGAGG + Intergenic
1071864520 10:89712496-89712518 CTTTGGAAGGCCAAGGGAAGAGG - Intronic
1072285261 10:93908396-93908418 ATTGGAAAGGGCAAGGTCTTTGG - Intronic
1072571397 10:96660939-96660961 CTTTGGGAGGCCAAGGTAGTTGG + Intronic
1072687691 10:97548550-97548572 CTTTGAAAGGCCAAGGCAGGCGG + Intronic
1072905096 10:99445765-99445787 CTTTGGAAGGCCAAGGTGAGCGG - Intergenic
1073002036 10:100293068-100293090 CCCTGAAAGGGAAAGGAAATAGG + Exonic
1073013448 10:100379572-100379594 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
1073126929 10:101156781-101156803 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
1073224879 10:101909701-101909723 CTTTGGAAGGGCAAGGCAGGAGG - Intronic
1073412809 10:103356304-103356326 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1073557693 10:104468455-104468477 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1073585109 10:104702529-104702551 CTTTGGAAGGCCAAGGCAAGCGG - Intronic
1074072854 10:110090462-110090484 CTTTGGAAGGCCAAGGTAGGCGG - Intronic
1074106063 10:110390510-110390532 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1074439751 10:113466330-113466352 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
1074541530 10:114369211-114369233 CTTTGAGAGGCCAAGGTGGTGGG + Intronic
1074676944 10:115861858-115861880 CTTTGAGAGGCCAAGGTATGAGG + Intronic
1075056781 10:119224655-119224677 CTTTGTAAGGCCAAGGCAGTTGG - Intronic
1075076749 10:119357118-119357140 CTTTGATAGGGCAAGGCATCTGG - Intronic
1075729282 10:124626735-124626757 CTGTGAAAGGTCTAGCTAATGGG - Intronic
1075834337 10:125440914-125440936 CTTTGGGAGGCCAAGGTAAGGGG + Intergenic
1076112070 10:127867776-127867798 CTTTGAAAGGGCAATGAAGAAGG + Intergenic
1076663810 10:132073739-132073761 CTTTGGAAGGCCAAGGCAAGTGG - Intergenic
1076770809 10:132663462-132663484 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1077777073 11:5283751-5283773 CTTTGGGAGGCCAAGGCAATTGG - Intronic
1078162587 11:8854630-8854652 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1078390033 11:10929523-10929545 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1078890748 11:15556252-15556274 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1079194106 11:18309755-18309777 CTTTGCGAGGGCAAGGTGATTGG + Intronic
1079838277 11:25363230-25363252 CTTTGAAAGGCCCAGGCAAGAGG + Intergenic
1080013052 11:27477400-27477422 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1080667953 11:34352387-34352409 TTTTTAAAGGGCAGGGTAATGGG - Intronic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1081881204 11:46454270-46454292 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1081882189 11:46462995-46463017 CTTTGAAAGGCCAAGGTAGGTGG - Intronic
1081945495 11:46989542-46989564 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1082082674 11:48024439-48024461 CTTTGGAAGGGCAAGGCAGGTGG - Intronic
1083469494 11:62873568-62873590 CTTTGCAAGGCCAAGGTAGGAGG - Intronic
1083561778 11:63678692-63678714 CTTTGGGAGGGCAAGGTAGGCGG - Intergenic
1083694710 11:64434862-64434884 CCTTGAATGGGCAAGGTGAGCGG - Intergenic
1083963419 11:66027249-66027271 CTTTGGAAGGGCAAGGCAGGCGG - Intergenic
1084202625 11:67571427-67571449 CTTTGGAAGGACAAGGCAAAAGG - Intergenic
1084239490 11:67809149-67809171 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1084384742 11:68836230-68836252 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
1084644601 11:70448145-70448167 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1084781465 11:71412426-71412448 GCTGGAAAGGGCAAGGAAATGGG + Intergenic
1085195082 11:74665641-74665663 CTTTGAGAGGCCAAGGTAGGCGG - Intronic
1085422227 11:76372640-76372662 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
1085635626 11:78157438-78157460 CTTTGAGAGGCCAAGGTCAGTGG - Intergenic
1085927896 11:81043955-81043977 CTTTGGGAGGGCAAGGTAGGTGG + Intergenic
1085958762 11:81434339-81434361 CTTTGAGAGGCCAAGGTGAGGGG - Intergenic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1087040112 11:93790861-93790883 CTTTGGAAGGCCAAGGCAGTTGG + Intronic
1087636539 11:100708266-100708288 CTTTGAAAGGTCTAGGTAGGAGG + Intronic
1087796156 11:102456304-102456326 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1088255517 11:107899769-107899791 CTTTGGGAGGCCAAGGTAAATGG - Intronic
1088488626 11:110365689-110365711 CTTTGAGAGGGCAAGATAGGTGG - Intergenic
1088511309 11:110578602-110578624 CTTTGAAAGGGTACTGAAATGGG + Exonic
1088628793 11:111753860-111753882 CTTTGAGAGGCCAAGGTAAGAGG - Intronic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089194941 11:116688735-116688757 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
1089599813 11:119606476-119606498 CATTGCAAGGGCAAGGTGTTGGG + Intergenic
1089636303 11:119814871-119814893 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1089859951 11:121580846-121580868 CTTTGAGAGGACAAGGTAAGAGG - Intronic
1089934997 11:122355348-122355370 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1089939181 11:122397494-122397516 CTTTGAAAGGCCAAGGTTGGGGG + Intergenic
1089970478 11:122689041-122689063 CTTTGAGAGGGCGAGGCAAGTGG - Intronic
1090418277 11:126555983-126556005 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1090910965 11:131118934-131118956 CTTTGAGAGGGCAAGGTGGAAGG - Intergenic
1092035570 12:5331890-5331912 CTTGGAAAGGGCAAGTCAGTGGG - Intergenic
1092048622 12:5451934-5451956 CTTTGGGAGGCCAAGGTGATAGG - Intronic
1092179999 12:6440147-6440169 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1092186926 12:6487150-6487172 CTTTGGGAGGGCAAGGTAGGTGG + Intergenic
1092371919 12:7923701-7923723 CTTTGGAAGGCCAAGGTTAGAGG - Intronic
1092665122 12:10787846-10787868 CTTTGGAAGGCCGAGGTAAGTGG - Intergenic
1092883507 12:12906325-12906347 CTTTGGGAGGGCAAGGCAAGAGG + Intronic
1093455578 12:19361925-19361947 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1093732303 12:22579385-22579407 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1094193574 12:27721841-27721863 CTTTGAGAGGCCAAGGAAAAAGG + Intronic
1094613323 12:32014436-32014458 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1094619760 12:32068537-32068559 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1094639815 12:32262898-32262920 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1095044238 12:37482749-37482771 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1095745729 12:45656572-45656594 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1095880451 12:47130431-47130453 CTTTGAGAGGCCAAAGTAAGAGG + Intronic
1095988119 12:48014110-48014132 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
1095994233 12:48065944-48065966 CTTTGAGAGGCCAAGGTAGGGGG - Intronic
1096056774 12:48659354-48659376 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1096267616 12:50136227-50136249 CTTTGGGAGGGCAAGGTGGTCGG + Intronic
1096844455 12:54398139-54398161 CTTTGGAAGGCCAAGGCAAGTGG - Intronic
1097126168 12:56777337-56777359 CTTTGGAAGGCCAAGGCAAGTGG - Intronic
1097291805 12:57922946-57922968 CTTTGGAAGGCCAAGGTAGATGG - Intergenic
1097559375 12:61183587-61183609 CTTTGACAATGCAAGGTAAATGG + Intergenic
1097559409 12:61184310-61184332 CTTTGACAGTGCAAGGTAAATGG - Intergenic
1097644105 12:62215360-62215382 ATGGGAAAAGGCAAGGTAATAGG + Intronic
1097792372 12:63828590-63828612 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
1097796396 12:63867092-63867114 CTTTGGAAGGCCAAGGTAAGAGG - Intronic
1098039876 12:66342937-66342959 CTTTGGGAGGCCAAGGTAAGCGG - Exonic
1098139321 12:67435627-67435649 CTATTAAAAGTCAAGGTAATGGG - Intergenic
1098543190 12:71682343-71682365 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
1098597040 12:72285760-72285782 CTTTGAGAGGCCAAGGTAGGCGG - Intronic
1098655170 12:73019164-73019186 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1098667467 12:73181349-73181371 CTTTGGAAGGGCAAGGCAGGTGG - Intergenic
1099079775 12:78162618-78162640 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1099316734 12:81093204-81093226 CTTTGTGAGGCCAAGGTAAGCGG + Intronic
1099348933 12:81540152-81540174 CTTTGATAGGGCAAGAGAACAGG - Intronic
1099352750 12:81592999-81593021 CTTTGCAAGGCCAAGGCAAGTGG - Intronic
1100551779 12:95652800-95652822 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1100630092 12:96379923-96379945 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1100997922 12:100322511-100322533 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
1101148168 12:101861373-101861395 GTTTGAGAGGACAAGGTAAGAGG + Intergenic
1101184674 12:102262616-102262638 CTTTGGAAGGCTAAGGTAAGAGG - Intergenic
1101281435 12:103261225-103261247 CTTTGAAAAGCCAAGGCAAGTGG + Intronic
1101474040 12:105027116-105027138 CTTTGCAAGGGCAAGGTTGGGGG - Intronic
1101480166 12:105089003-105089025 CTTTGGAAGGCCGAGGTAAGAGG + Intergenic
1101633546 12:106518582-106518604 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1101815485 12:108143055-108143077 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1101888935 12:108694046-108694068 CTTTGGGAGGGCAAGGCAAGAGG + Intronic
1102081639 12:110103120-110103142 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1102085901 12:110139429-110139451 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1102109670 12:110355527-110355549 CTTTGGGAGGCCAAGGTAGTTGG + Intergenic
1102121417 12:110444526-110444548 CTTTGGAAGGCCAAGGCAAGTGG - Intronic
1102169140 12:110828891-110828913 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1102212509 12:111137756-111137778 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
1102343086 12:112139092-112139114 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1102437886 12:112939562-112939584 CTTTGAAAGGCCAAGGCAAGTGG - Intronic
1102901311 12:116639623-116639645 CTTTGAAAGAGAAAGCCAATAGG - Intergenic
1103020416 12:117529457-117529479 CTTTGGGAGGGCAAGGTAGGAGG - Intronic
1103065242 12:117892053-117892075 CTTTGGGAGGCCAAGGTAAGTGG + Intronic
1103095414 12:118128253-118128275 CTTTGTAAGGCCAAGGTAGGAGG - Intronic
1103117892 12:118352951-118352973 CTTTGGGAGGTCAAGGTAAATGG - Intronic
1103118794 12:118362772-118362794 CTTTGGAAGGCCAAGGTAGATGG + Intronic
1103253311 12:119519704-119519726 CTTTGGGAGGGCAAGGCAAGCGG - Intronic
1103303080 12:119943005-119943027 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
1103511230 12:121475918-121475940 CTTTGGGAGGGCAAGGTAGGAGG + Intronic
1103537780 12:121645206-121645228 CTTTGAAAGGCCAAGGCGAGGGG - Intergenic
1103556442 12:121769460-121769482 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
1103694026 12:122799667-122799689 CTTTGAAAGGGAGAGGGATTAGG + Intronic
1103802095 12:123544974-123544996 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
1103950231 12:124546654-124546676 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1103984712 12:124759600-124759622 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1104368795 12:128203781-128203803 ATTTAAAAGAGAAAGGTAATAGG - Intergenic
1105067436 12:133213096-133213118 CTTTGGGAGGCCAAGGTAAGTGG - Intergenic
1106153877 13:27133886-27133908 CTTTGGGAGGTCAAGGCAATAGG + Intronic
1106189943 13:27442800-27442822 TTTTTAAAAGGCAAGGTAATGGG - Intronic
1106244952 13:27941151-27941173 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1106321518 13:28643924-28643946 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
1106713721 13:32366576-32366598 CTTTGAGAGGCCAAGGTGAATGG + Intronic
1106822442 13:33480201-33480223 TATTGAAAGAGCAAGGAAATGGG + Intergenic
1107082117 13:36386191-36386213 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
1107149845 13:37098537-37098559 ATTTGAAAGGGAGAGTTAATAGG - Intergenic
1107206546 13:37796847-37796869 CTTTGAGAGGCCAAGGCAATAGG + Intronic
1107270549 13:38610852-38610874 CTTTGAAAGGCCAAGGTGAGTGG - Intergenic
1107488336 13:40853966-40853988 CTTTGAAAGGCCGAGGTAGGTGG - Intergenic
1107510175 13:41075622-41075644 CTTTGAAAAGGCGAGGTAGGAGG - Intronic
1107907200 13:45072257-45072279 CTTTGAGAGGCCAAGGTGAGAGG - Intergenic
1107926946 13:45272497-45272519 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
1108010702 13:46005848-46005870 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1108121735 13:47195244-47195266 CTTTGGGAGGCCAAGGTAGTTGG + Intergenic
1108168886 13:47721026-47721048 TCTTGAAAGAGCATGGTAATGGG + Intergenic
1108676886 13:52744792-52744814 CTTTGAAAGGCCAAGGGAGGAGG - Intergenic
1108806145 13:54158876-54158898 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
1108904726 13:55453981-55454003 CTTTGGAAGGACAAGGTAGGTGG + Intergenic
1109193809 13:59356139-59356161 TTTTGAAAAGTCAAGGTGATTGG + Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110236836 13:73225807-73225829 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1110238419 13:73240796-73240818 CTTTGGGAGGCCAAGGTAGTGGG + Intergenic
1110374457 13:74776601-74776623 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1110717121 13:78718663-78718685 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1111117786 13:83803711-83803733 CTTTGGAAGGCCAAGGTAAGAGG + Intergenic
1111475052 13:88735136-88735158 CTTTGGGAGGGCAAGGTGAATGG + Intergenic
1111482972 13:88856247-88856269 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1111930852 13:94511601-94511623 CTTTGGGAGGGCAAGGCAAGTGG - Intergenic
1112158447 13:96843431-96843453 CTTTGGGAGGCCAAGGCAATCGG + Intergenic
1112273107 13:97988542-97988564 CTTTGGAAGGCCAAGGCAAGTGG + Intronic
1112400274 13:99071377-99071399 CTTTGGAAGGCCAAGGTAGATGG - Intronic
1113459819 13:110473879-110473901 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1114161270 14:20170378-20170400 CTTTGAAAGGCCAAGTTGAGTGG + Intergenic
1115759671 14:36567102-36567124 CTTTGGAAGGCCAAGGCAAGTGG - Intergenic
1115826793 14:37287495-37287517 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1115842886 14:37491283-37491305 CTTTGAGAGGCCGAGGTAAGTGG + Intronic
1115986440 14:39107176-39107198 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1116175630 14:41466541-41466563 CTTTGAAATGGGAAGATAGTAGG - Intergenic
1116449663 14:45050494-45050516 CTTTGAGAGGACAAGGTAGGTGG - Intronic
1116461865 14:45186135-45186157 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1117161202 14:52992060-52992082 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1117386660 14:55221069-55221091 CTTTGAAAGGTCAAGGTGGGCGG + Intergenic
1117704409 14:58449281-58449303 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
1117706572 14:58475854-58475876 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
1117979520 14:61328742-61328764 CTTTGGGAGGCCAAGGCAATAGG + Intronic
1118220044 14:63847199-63847221 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1118224035 14:63882470-63882492 CTTTGAGAGGCCAAGGTGAAAGG + Intronic
1118397989 14:65354009-65354031 CTTTGGAAGGGCGAGGTAGGGGG + Intergenic
1118571738 14:67201050-67201072 CTTTGAAAGGACAAGGCAGGAGG + Intronic
1118841297 14:69514952-69514974 CTTTGAAAGGCCAAGGCAGTTGG + Intronic
1119156739 14:72418408-72418430 CTTTGGGAGGCCAAGGTAAGTGG - Intronic
1119333695 14:73814766-73814788 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
1119512746 14:75224295-75224317 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
1119823742 14:77640475-77640497 CTTTGAGAGTCCAAGGTAAGTGG + Intergenic
1120376879 14:83719613-83719635 CTTTGAAAGGCCAAGGCAGGCGG - Intergenic
1120644442 14:87056679-87056701 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1121188231 14:91996431-91996453 CTTTGAGAGGCCAAGGCAAAAGG + Intronic
1121360929 14:93258826-93258848 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
1121451575 14:94011585-94011607 CTTTGAAGGTGCAGGGTCATGGG - Intergenic
1121631595 14:95424994-95425016 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1121785620 14:96658379-96658401 CTTTGGGAGGCCAAGGTAAATGG - Intergenic
1121898335 14:97669969-97669991 CTTTGAAAGGCCAAGGTTGGAGG - Intergenic
1122161848 14:99790825-99790847 CTTTGGCAGGGAAAGGAAATGGG - Intronic
1122452879 14:101825399-101825421 TTTTGAAAGGCCAAGATCATGGG + Intronic
1123005493 14:105320584-105320606 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1123724460 15:23088257-23088279 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1123873762 15:24602682-24602704 CTTTGAGAGGCCAAGGGAAGAGG - Intergenic
1124275789 15:28324936-28324958 CTTTGAGAGGGCAAGGCAGGCGG + Intergenic
1124424969 15:29556008-29556030 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1124451038 15:29791268-29791290 CTTTGGGAGGGCAAGGTGAGCGG - Intronic
1124825939 15:33095614-33095636 CTTTGAGAGGCCAAGGTGGTAGG - Intronic
1125472517 15:40018563-40018585 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1125550788 15:40542912-40542934 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1125572333 15:40730264-40730286 CTTTGGGAGGCCAAGGTGATAGG + Intronic
1125586255 15:40822403-40822425 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1125648342 15:41292263-41292285 CTTTGGGAGGCCAAGGCAATTGG - Intergenic
1125837137 15:42762472-42762494 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1127195973 15:56586103-56586125 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1127441116 15:59009200-59009222 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
1127881274 15:63160381-63160403 CTTTGACAGAGCTAGGTAGTGGG - Intergenic
1128459796 15:67858198-67858220 CTTTGGGAGGGCAAGGTGAGAGG + Intergenic
1128472040 15:67962588-67962610 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1128557366 15:68641044-68641066 CTTTGAAAGGGCCAGGGGAAGGG - Intronic
1128577539 15:68786501-68786523 CTTTGAGAGGGCAAGGCAGGTGG - Intronic
1128642037 15:69346541-69346563 CTTTGCAAGGCCAAGGTGAGAGG - Intronic
1128822672 15:70674103-70674125 CTTTGGAAGGCCGAGGCAATTGG - Intronic
1129438892 15:75564711-75564733 CTTTGGGAGGGCAAGGTAGGAGG + Intronic
1129805641 15:78454931-78454953 CTTTGAGAGGCCAAGGTAAGAGG - Intronic
1129812106 15:78519514-78519536 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
1129860592 15:78857782-78857804 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
1130535372 15:84781289-84781311 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
1130542191 15:84828326-84828348 CCTTGGAAGGGGAAGATAATGGG + Intronic
1130583836 15:85163700-85163722 CTTTGAGAGGCCAAGGCAAGTGG - Intergenic
1131301924 15:91207264-91207286 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
1131466373 15:92657795-92657817 CTTTGGGAGGCCAAGGTAAGTGG + Intronic
1131863934 15:96686611-96686633 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1131954576 15:97718694-97718716 CTTTGAAAGGCCAAGGTAGGAGG - Intergenic
1131975481 15:97941800-97941822 CTTTGAGAGGCCAAGGTGAATGG + Intergenic
1132143562 15:99413683-99413705 CTTTGGGAGGCCAAGGTAAGTGG - Intergenic
1132220825 15:100103817-100103839 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1132526101 16:415657-415679 CTTTGGAAGGTCAAGGTCAGTGG + Intergenic
1132825122 16:1900852-1900874 CTTTGGAAGGGCAAGGCAGGAGG + Intergenic
1132944484 16:2525299-2525321 CTTTGGAAGGCCAAGGCAGTTGG - Intronic
1133163396 16:3928066-3928088 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1133186300 16:4101520-4101542 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1133195348 16:4166090-4166112 CTTTGGGAGGGCAAGGCAAGCGG + Intergenic
1133301782 16:4787117-4787139 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1133415038 16:5599921-5599943 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1133669085 16:7999965-7999987 CTTTGGAAGGCCAAGGCAAGTGG + Intergenic
1134060058 16:11194027-11194049 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1134118844 16:11569483-11569505 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1134647068 16:15877521-15877543 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
1134665782 16:16017650-16017672 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1134665950 16:16018892-16018914 CTTTGAAAGGCCAAGGCTAGAGG + Intronic
1135249676 16:20890382-20890404 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
1135305855 16:21367117-21367139 CTTTGAGAGGCCAAGGTGAGAGG - Intergenic
1135432619 16:22399134-22399156 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1135504288 16:23022601-23022623 CTTTGAGAGGCCAAGGCAAGTGG + Intergenic
1135713709 16:24742077-24742099 CTTTGGAAGGCCAAGGTGGTAGG - Intronic
1135882003 16:26266906-26266928 CATTGAAAGGGCACGGGAACAGG - Intergenic
1135941928 16:26829312-26829334 CTTTGAAAGGTCAAGGTGGGTGG + Intergenic
1136042805 16:27593749-27593771 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1136073481 16:27802896-27802918 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1136302596 16:29346268-29346290 CTTTGAGAGGCCAAGGTGAGAGG - Intergenic
1137018935 16:35403579-35403601 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
1137436408 16:48457489-48457511 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1137630825 16:49943170-49943192 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1137647764 16:50090899-50090921 CTTTGATAGGCCAAGGCAGTTGG + Intronic
1137651977 16:50128397-50128419 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
1137705643 16:50533983-50534005 CTTTGGAAGGGAAAGATGATCGG + Intergenic
1137794008 16:51199461-51199483 CTTTGGAAGGCCAAGGTGGTAGG - Intergenic
1137794068 16:51200155-51200177 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1138070585 16:53989365-53989387 CATTGCAAAGGCAAGGTGATGGG + Intronic
1138440386 16:57030863-57030885 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
1138566887 16:57840092-57840114 CTTTGAGAGGCCAAGGTAGGCGG + Intronic
1138572899 16:57887127-57887149 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1138854826 16:60677633-60677655 CTTTGGAAGGCCAAGGTGAGCGG + Intergenic
1138913042 16:61426352-61426374 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1138947627 16:61871405-61871427 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1139120139 16:64006146-64006168 CTTTGAAAGGCCAAGGCTAGGGG - Intergenic
1139516066 16:67453075-67453097 CTCTGAAAGGCCAAGGTCTTAGG - Intronic
1139625469 16:68185218-68185240 CTTTGGAAGGCCAAGGCAAGCGG - Intronic
1140008086 16:71099756-71099778 CTTTGAGAGGACAAGGTAGGAGG + Intronic
1140021071 16:71239457-71239479 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1140193491 16:72837843-72837865 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1140240507 16:73195658-73195680 CTTTGAAAGGCCAAGGCAGATGG - Intergenic
1140283971 16:73582718-73582740 CTTTGAGAGGCCAAGGTGAGTGG - Intergenic
1140879996 16:79189542-79189564 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1141060342 16:80861331-80861353 CTTTGGAAGGTCAAGGTGAGAGG + Intergenic
1141068238 16:80931239-80931261 CTTTGAGAGGCCAAGGTGAGCGG + Intergenic
1141487670 16:84351699-84351721 CTTTGAAAGGTCAAGGTGAGAGG - Intergenic
1141525518 16:84608660-84608682 CTTTGAGAGGCCAAGGCAAGTGG + Intronic
1141551282 16:84808314-84808336 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1141668162 16:85476854-85476876 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1142326515 16:89418963-89418985 CTTTGGAAGGCCGAGGTGATTGG - Intronic
1142436893 16:90065489-90065511 CTTTGGGAGGCCAAGGTAGTAGG + Intronic
1142527966 17:558222-558244 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1142554206 17:762115-762137 CTTTCAAAGGGAAAGCTGATAGG + Intronic
1142791681 17:2271468-2271490 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1142970465 17:3607969-3607991 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
1143496672 17:7316367-7316389 CTTTGCAAGGGGGAGGTGATGGG - Intronic
1143742373 17:8964145-8964167 CTTTGGAAGGCCAAGGTAGACGG + Intronic
1143913659 17:10273004-10273026 CTTTGGAAGGTCAAGGTGAGCGG - Intergenic
1144000976 17:11054775-11054797 CTTTGGGAGGCCAAGGTAAGTGG - Intergenic
1144043747 17:11436170-11436192 CTTTGAAAGTGCAAGGGGAGAGG - Intronic
1144112984 17:12056531-12056553 ATTTGAAAGGACATGGTAATAGG + Intronic
1144588879 17:16506850-16506872 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1145741584 17:27279413-27279435 CTTTGGGAGGGCAAGGTAGGTGG + Intergenic
1145871560 17:28277653-28277675 CTTTGGGAGGCCAAGGTAAATGG + Intergenic
1146093117 17:29902028-29902050 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1146140482 17:30363603-30363625 CTTTGAGAGGTGAAGGTAAGAGG + Intergenic
1146140604 17:30364791-30364813 CTTTGCAAGGCCAAGGGAAGTGG - Intergenic
1146214352 17:30967271-30967293 CTTTGAGAGGCCAAGGTGAGCGG - Intergenic
1146232366 17:31124306-31124328 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
1146245546 17:31278993-31279015 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
1146323301 17:31863942-31863964 CTTTGGAAGGCCAAGGTAGAAGG - Intronic
1146355052 17:32126777-32126799 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1147001585 17:37366842-37366864 CTTTGGGAGGCCAAGGCAATAGG + Intronic
1147061510 17:37883138-37883160 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1147532037 17:41288423-41288445 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1147674687 17:42196767-42196789 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
1147783128 17:42958256-42958278 CTTTGAGAGGCCAAGGCAAGTGG + Intronic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148351542 17:46945093-46945115 CTGTGAGAGGGCGAGGTGATGGG + Intronic
1148526203 17:48338393-48338415 CTTTGAGAGGCCAAGGTGAGTGG - Intronic
1148548379 17:48533877-48533899 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1148696662 17:49564120-49564142 CTTTGAGAGGCCAAGGCAAAAGG + Intergenic
1148803715 17:50252179-50252201 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1148931272 17:51129165-51129187 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1148948917 17:51291489-51291511 CTTTGAGAGGTCAAGGTGAGAGG + Intronic
1149278002 17:55066465-55066487 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1149417542 17:56475580-56475602 ATTTAAAAGGGTAAGGTAAAGGG - Intronic
1149640471 17:58199474-58199496 CTTTGAAAAGGCAAGGGTATGGG + Intronic
1149907654 17:60541333-60541355 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1149966195 17:61166639-61166661 CTTTGAGAGGGCAAGGCAGGCGG - Intronic
1150102057 17:62432423-62432445 CTTTGGAAGGCCAAGGAGATAGG + Intronic
1150115273 17:62542348-62542370 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1150128746 17:62654894-62654916 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1150179201 17:63097288-63097310 CTTTGAGAGGCCAAGGCAAGTGG - Intronic
1150237297 17:63603460-63603482 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1150691756 17:67373117-67373139 CTTTGGGAGGCCAAGGTAGTTGG + Intergenic
1150734263 17:67722932-67722954 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1151134291 17:71930879-71930901 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1151210066 17:72537842-72537864 CTTTGAGAGGGCAAGGTGGGCGG - Intergenic
1151259132 17:72903021-72903043 CTTTGGGAGGCCAAGGTAAGTGG + Intronic
1151272234 17:73005703-73005725 CTTTGGAAGGCCAAGGCAAGCGG + Intronic
1151532673 17:74716888-74716910 CTTTGGGAGGGCAAGGTAGGCGG + Intronic
1151586143 17:75009658-75009680 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
1151634590 17:75336979-75337001 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1151744482 17:76004593-76004615 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1151783045 17:76260193-76260215 CTTTGTAAGGTCAAGGTGAGAGG + Intergenic
1151807566 17:76415559-76415581 CTTTGAGAGGGCAAGGCGGTTGG + Intronic
1152199580 17:78937500-78937522 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1152272994 17:79336141-79336163 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
1153002671 18:470179-470201 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
1153321853 18:3781069-3781091 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1154245462 18:12693065-12693087 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
1154358000 18:13637039-13637061 CTTTGCAAGGCCAAGGTGAGTGG - Intronic
1155129669 18:22920077-22920099 CTTTGAGAGGCCACGGTAAGCGG + Intronic
1155147978 18:23099621-23099643 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1155245236 18:23902077-23902099 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
1155285371 18:24282863-24282885 CTTTGAGAGGCCAAGGTAAAAGG + Intronic
1155314384 18:24557186-24557208 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1155777892 18:29791336-29791358 CTTTGCAAGGCCAAGGTGAGAGG - Intergenic
1156160312 18:34350980-34351002 CTCTGGAAGGGGAAGCTAATGGG + Intergenic
1156266826 18:35496767-35496789 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1156727131 18:40141963-40141985 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1156767669 18:40677710-40677732 CTTTGGAAGGCCAAGGCAAGCGG - Intergenic
1156988290 18:43375489-43375511 CTATGGAAGAGAAAGGTAATTGG + Intergenic
1157378523 18:47189498-47189520 CTTTGGAAGGACAAGGTGAGAGG - Intergenic
1157487957 18:48102318-48102340 CTTTGGGAGGCCAAGGTAACAGG + Intronic
1157755647 18:50214925-50214947 CTTAGAAAGGGCATGGAATTTGG + Intergenic
1158503323 18:58023129-58023151 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1158719794 18:59914705-59914727 CTTTGAAAAGTCAAGGAAAGAGG + Intergenic
1158958479 18:62565999-62566021 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
1158988207 18:62841129-62841151 CTTTGAAAGGTCAAGGCAGGTGG - Intronic
1159649947 18:70966030-70966052 CTTTGAAAGGCCAAGGCAGGCGG - Intergenic
1160135481 18:76267582-76267604 CTTTGCAAGGCCAAGGTAGGCGG + Intergenic
1160274930 18:77422665-77422687 ATTTGAAGGGGCAAAGAAATGGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161157612 19:2740964-2740986 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
1161180384 19:2876967-2876989 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
1161365461 19:3876797-3876819 CTTTGGGAGGCCAAGGTAAGCGG + Intergenic
1161490893 19:4560680-4560702 CTTTGAGAGGGCAAGGCGAGTGG - Intergenic
1161525763 19:4754056-4754078 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1161789864 19:6353389-6353411 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1162052928 19:8046072-8046094 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1162237245 19:9319071-9319093 CTTTGATAAGGAAAGGTAGTGGG + Intergenic
1162245063 19:9393078-9393100 CTTTAAAAGGCCAAGGCAAGAGG + Intergenic
1162468543 19:10857984-10858006 CTTTGAAAGGCCGAGGCAAGTGG + Intronic
1162586602 19:11563175-11563197 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1162682365 19:12355722-12355744 CTTTGAGAGGCCAAGGCAAGTGG + Intronic
1162725272 19:12686564-12686586 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1162855230 19:13463002-13463024 CTTTGAAAGGCCAAGGTGAGAGG - Intronic
1163140024 19:15341299-15341321 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1163344326 19:16730468-16730490 CTTTGAGAGGCCAAAGCAATTGG + Intronic
1163356795 19:16818058-16818080 CTTTGAAAGGCCAAGGTAGAAGG + Intergenic
1163411092 19:17155021-17155043 CTTTGGAAGGCCAAGGCAACAGG + Intronic
1163468015 19:17480619-17480641 CTTTGAAAGGTCAAGGTGGGAGG - Intronic
1163535770 19:17875517-17875539 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1163796136 19:19339067-19339089 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1163813591 19:19450031-19450053 CTTTGGAAGGTCAAGGCAAGAGG - Intronic
1163944920 19:20527046-20527068 CTTTGAGAGACCAAGGTAAGAGG - Intergenic
1163975662 19:20849415-20849437 CTTTGAGAGGCCAAGGCAGTTGG + Intronic
1164602568 19:29572716-29572738 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1164647293 19:29868686-29868708 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1165071481 19:33257497-33257519 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1165137435 19:33678496-33678518 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1165338150 19:35188059-35188081 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1165911394 19:39230429-39230451 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1166016561 19:39984572-39984594 CTTTGGGAGGGCAAGGTGGTCGG - Intronic
1166090938 19:40508441-40508463 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
1166149271 19:40859934-40859956 CTTTGGGAGGCCAAGGTAGTAGG - Intronic
1166205953 19:41269220-41269242 CTTTGGGAGGCCAAGGTAGTAGG + Intronic
1166582972 19:43918963-43918985 CTGTGAAAAGGCAAGGACATAGG + Intronic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1166767351 19:45259516-45259538 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1166929123 19:46290597-46290619 CTTTGCAAGGCCAAGGCAGTTGG + Intergenic
1167062851 19:47161252-47161274 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1167094430 19:47366815-47366837 CTTTGAAAGGCCAAGGCAAGCGG - Intronic
1167176720 19:47869545-47869567 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1167272785 19:48515687-48515709 CTTTGGAAGGCCAAGGCAAGTGG - Intergenic
1167316952 19:48769711-48769733 CTTTGAGAGGCCAAGGTAGAAGG + Intergenic
1167329195 19:48844042-48844064 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1167329485 19:48846078-48846100 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1167378198 19:49123376-49123398 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1167392487 19:49205063-49205085 CTTTGGAAGGCCAAGGCAAGAGG - Intronic
1167440140 19:49503607-49503629 CTGTGAAAAGGCAAGGCCATTGG - Intergenic
1167849957 19:52193866-52193888 CTTTGGAAGGCCAAGGTGAAAGG + Intronic
1167877132 19:52423612-52423634 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1168501928 19:56900095-56900117 CTTTGAGAGGCCAAGGTGAAAGG + Intergenic
1168709452 19:58490376-58490398 CTTTGAAAGGCCGAGGCAGTCGG + Intronic
925435714 2:3835985-3836007 CTTTGGGAGGTCAAGGTAAAAGG - Intronic
925553102 2:5097270-5097292 CTTTGAGAGGTCAAGGCAAGTGG - Intergenic
926155603 2:10452251-10452273 CATTCAAAGGGCAAGGTTAAAGG - Intergenic
926177736 2:10611536-10611558 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
927528197 2:23768288-23768310 CTTTGGGAGGGAAAGGTAGTAGG + Intronic
927736873 2:25532001-25532023 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
927800423 2:26094130-26094152 CTTTGGCAGGCCAAGGTAAGAGG - Intronic
928010571 2:27603839-27603861 CTTTGGGAGGTCAAGGTAAGAGG - Intronic
928019554 2:27692054-27692076 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
928040022 2:27865655-27865677 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
928508446 2:31978661-31978683 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
928967113 2:36987823-36987845 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
929017422 2:37512728-37512750 CTTTGAAAGGCCAAGGTAGGTGG - Intergenic
929128740 2:38545228-38545250 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
929411700 2:41703886-41703908 CTTTGAAAGGGTTAGGTTGTTGG - Intergenic
929629178 2:43441750-43441772 CTTTAAAAGGCCAAGATCATAGG + Intronic
929644125 2:43610364-43610386 CTTTGAGAGGGCAAGGCAGGAGG + Intergenic
929688429 2:44054681-44054703 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
929719725 2:44355302-44355324 CTTTGAGAGGGCAAGGCAGGTGG + Intronic
929752671 2:44732195-44732217 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
929766908 2:44851741-44851763 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
930045424 2:47167448-47167470 CTTTGGGAGGTCAAGGTAAGCGG + Intronic
930062553 2:47302447-47302469 CTTGGCAAGGGAAAGGTTATGGG + Intergenic
930154045 2:48087533-48087555 CTTTGAGAGGCCAAGGTAGGGGG - Intergenic
930547041 2:52781446-52781468 CTCTGAAAGGACAAGAGAATAGG - Intergenic
930808439 2:55516589-55516611 CTTTGAGAGGCCAAGGTGAGTGG - Intergenic
931438006 2:62265744-62265766 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
931527409 2:63172260-63172282 CTTTGAAAGGCCGAGGCAAAAGG + Intronic
931544603 2:63368567-63368589 CTTTGAGAGGCCAAGGTGAGTGG - Intronic
931747799 2:65305769-65305791 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
932151210 2:69373371-69373393 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
932233991 2:70106503-70106525 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
932502955 2:72200447-72200469 CTTTGGAAGGCCAAGATAGTGGG - Intronic
932505575 2:72227982-72228004 ATATGAAAGGGCAAGGAATTTGG + Intronic
933022025 2:77206084-77206106 CTTTAGAAGGCCAAGGTAGTTGG - Intronic
933076926 2:77940521-77940543 CTTTGAGAGGCCAAGGAAAGGGG + Intergenic
933232203 2:79821450-79821472 CTTTGAAAGGCCAAGGCAATAGG - Intronic
933414624 2:81970421-81970443 CTTTGAGAGGCCAAGGAAAGAGG - Intergenic
933674783 2:85045001-85045023 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
933716004 2:85361304-85361326 CTTTCAAAGAGCCAGGAAATCGG + Intronic
933756643 2:85644664-85644686 CTTTGAGAGGTCAAGGTAGGAGG - Intronic
933828294 2:86184417-86184439 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
933834895 2:86237936-86237958 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
933951167 2:87331644-87331666 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
935296630 2:101655451-101655473 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
935296851 2:101657170-101657192 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
935429104 2:102955640-102955662 CTTTGGGAGGCCAAGGTAAATGG + Intergenic
935887446 2:107637505-107637527 CTTTGAGAGGCCAAGGTAGATGG - Intergenic
935993003 2:108738466-108738488 CTTTGGAAGGCCAAGGCAAGCGG - Intronic
936662177 2:114554742-114554764 CTTTGAAGAGTCAAAGTAATTGG - Intronic
936766053 2:115849707-115849729 CTTTGGAAGGCCAAGGCAGTCGG - Intergenic
936785335 2:116087720-116087742 CTTTAAAAGGGCCAGGAAAGAGG + Intergenic
937032593 2:118753056-118753078 CTCTGAGGGGGCAGGGTAATTGG - Intergenic
937208963 2:120254917-120254939 CTTTGAGAGGCCAAGGTGGTAGG - Intronic
938016060 2:127868108-127868130 CTTTGGGAGGGCAAGGTAGGTGG - Intronic
938327664 2:130423211-130423233 CTTTGAAAGGCCAAGGCAAGTGG + Intergenic
938362283 2:130698267-130698289 CTTTGAAAGGCCAAGGCAAGTGG - Intergenic
938438679 2:131304956-131304978 CTTTGAGAGGCCAAGGCAAGTGG - Intronic
938548732 2:132360413-132360435 CTTTGAGAGGCCAAGGTGAGCGG + Intergenic
938861488 2:135374161-135374183 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
939169210 2:138674526-138674548 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
939226465 2:139370895-139370917 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
939480891 2:142745786-142745808 CTTTGAGAGGGCAAGGTGAAAGG + Intergenic
939674693 2:145057869-145057891 CTTTGGGAGGCCAAGGTAAATGG - Intergenic
939934258 2:148270630-148270652 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
939949488 2:148452250-148452272 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
941080227 2:161052030-161052052 CTTTGAAGTGTCAATGTAATTGG + Intergenic
941087719 2:161137278-161137300 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
941287758 2:163635322-163635344 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
941704355 2:168642030-168642052 TTTTAAAAAGGCAAAGTAATGGG - Intronic
941812054 2:169765003-169765025 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
941817045 2:169806206-169806228 CTTTGGGAGGTCAAGGTGATTGG - Intronic
941955407 2:171199265-171199287 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
942012624 2:171777956-171777978 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
942049977 2:172130539-172130561 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
942180681 2:173377628-173377650 CTTTGAGAGGCCAAGGCAAGTGG - Intergenic
942651119 2:178169258-178169280 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
942715020 2:178882126-178882148 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
942763335 2:179426300-179426322 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
943046842 2:182870081-182870103 CTTTGAGAGGCCAAGGTGGTTGG - Intergenic
943296133 2:186142134-186142156 CTCTGAAAAGGCAAGCTACTTGG + Intergenic
943529057 2:189055783-189055805 CTTTGAAATTGCAATGTGATAGG - Intronic
943993810 2:194733776-194733798 CCTGGTAAGGGCAAGGTAATCGG - Intergenic
944294507 2:198047423-198047445 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
944561742 2:200946231-200946253 CTTTGAGAGGAAAAGGTAAGAGG - Intronic
944629414 2:201608254-201608276 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
944704136 2:202271697-202271719 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
944806415 2:203286062-203286084 CTTTGGGAGGCCAAGGTAAGTGG + Intronic
944909144 2:204292213-204292235 CTTTTAAAAGGCAAGAAAATGGG + Intergenic
945041024 2:205743985-205744007 CTTTGAGAGGCCAAGGCAAGTGG - Intronic
945158704 2:206865966-206865988 CTTGGCAGGGGCAAGGTAAAAGG - Intergenic
945275852 2:207986921-207986943 CTTTGGAAGGCCAAGGCAATAGG - Intronic
945961071 2:216135552-216135574 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
946001206 2:216484086-216484108 CTTTGAGAGGCCAAGGTGAGTGG + Intergenic
946349975 2:219143955-219143977 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
946554797 2:220843971-220843993 CTTTGAAAGGCCAAGGCAGACGG - Intergenic
946659468 2:221984305-221984327 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
946857932 2:223971580-223971602 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
946977809 2:225173185-225173207 CTTTGGAAGGCCAAGGTCAGTGG + Intergenic
947048570 2:226017421-226017443 CTTTGAGAGGCCAAGGTGAGCGG - Intergenic
947784860 2:232807813-232807835 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
948097767 2:235350089-235350111 CTTTGAGAGGACACGGGAATTGG + Intergenic
948214552 2:236219117-236219139 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
948303611 2:236929507-236929529 CTTTGGGAGGGCAAGGTAGGTGG + Intergenic
1168781050 20:490645-490667 CTTGGAAAGGCCAAGGCAAGTGG - Intronic
1169052341 20:2591459-2591481 CTTTGGGAGGCCAAGGTAGTAGG + Intronic
1169099873 20:2938073-2938095 CTTTGAGAGGCCAAGGTAAGAGG + Intronic
1169452776 20:5726403-5726425 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1169718732 20:8648694-8648716 CTTTGAAAGGCCAAGGCAGAAGG + Intronic
1169858725 20:10130248-10130270 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1170235001 20:14093328-14093350 CTTTGAGAGGTCTAGGTAGTAGG - Intronic
1170344870 20:15373644-15373666 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1170554862 20:17506766-17506788 CTTTGGGAGGGCAAGGTGAGTGG - Intronic
1170957696 20:20996411-20996433 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1171222533 20:23412750-23412772 CTTTGGGAGGCCAAGGCAATTGG + Intronic
1171844851 20:30261377-30261399 CTTTGAGAGGGCAAGGTGGGTGG - Intergenic
1172023322 20:31931320-31931342 CTTTGGAAGGGCAAGGCAGGAGG - Intronic
1172074513 20:32283874-32283896 CTTTGAGAGGCCAAGGTGAGTGG - Intronic
1172145922 20:32758348-32758370 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1172369346 20:34375767-34375789 CTTTGGGAGGCCAAGGTGATAGG + Intronic
1172370415 20:34385304-34385326 CTTTGCAAGGCCAAGGTGAGCGG - Intronic
1172534407 20:35661194-35661216 CTTCAAAAGGGAAAGGTAAATGG + Intronic
1172549563 20:35788477-35788499 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1172726467 20:37046854-37046876 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1172948616 20:38707308-38707330 CTTTGAAAGGCCAAGGTGGGCGG - Intergenic
1173138340 20:40459874-40459896 CTTTGGAAGGCCAAGGTAGATGG + Intergenic
1173587065 20:44190725-44190747 CTTTGAGAGGCCAAGGTAGGCGG + Intergenic
1173805023 20:45919089-45919111 CTTTGAAAGGCCAAGGCGAGAGG - Intergenic
1174469488 20:50745748-50745770 CTTTGGAAGGGCGAGGTGAGAGG - Intronic
1174638206 20:52020113-52020135 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1174791348 20:53481326-53481348 CTTTGGGAGGTCAAGGCAATAGG + Intronic
1174819856 20:53717120-53717142 CTTTGAGAGGCCAAGGCAAGCGG - Intergenic
1175037698 20:56015940-56015962 CTTTGGGAGGCCAAGGCAATTGG - Intergenic
1175657937 20:60788161-60788183 CTTTGAAAAGACGAGGTGATGGG - Intergenic
1176142709 20:63552350-63552372 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1176238301 20:64064338-64064360 CTTTGAAGGGGCCAGGTCAGTGG + Intronic
1176724096 21:10415551-10415573 CTTTGAGAGGCCAAGGCAAGTGG - Intergenic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1177048172 21:16198035-16198057 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1177135898 21:17305050-17305072 CTTTGAGAGTGCGTGGTAATAGG - Intergenic
1177169813 21:17642584-17642606 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1178156710 21:29862229-29862251 ATTTGAAAGGTCAAGGCAAGAGG - Intronic
1178277574 21:31252885-31252907 CTTTGAAAGGGCAAGGTAATTGG - Intronic
1178574788 21:33776306-33776328 CTTTGAGAGGGCAAGGTAAGAGG + Intronic
1179039311 21:37787720-37787742 TTTTGAAAGCACAAGGGAATGGG + Intronic
1179258106 21:39735108-39735130 CTTTGGGAGGCCAAGGTAAGTGG - Intergenic
1179922277 21:44513719-44513741 CTTTGATAGGGCAAAGAAAGAGG + Intronic
1180741689 22:18057520-18057542 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1180964281 22:19778001-19778023 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1180967382 22:19797760-19797782 CCTTGAAAGGGCAGGATGATGGG - Intronic
1180993066 22:19950326-19950348 CTTTGGGAGGCCAAGGTAAGTGG - Intronic
1181063450 22:20293253-20293275 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1181286007 22:21753176-21753198 CTTTGACAGGCCAAGGTAAGAGG - Intergenic
1181569548 22:23760701-23760723 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1181662582 22:24363468-24363490 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1181911094 22:26238977-26238999 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1181959543 22:26613006-26613028 CTTTGGAGGGGCTGGGTAATGGG - Intronic
1182106213 22:27691602-27691624 CTTTGGGAGGCCAAGGTAGTTGG + Intergenic
1182229603 22:28827500-28827522 CTTTGGGAGGCCAAGGTAAGTGG - Intergenic
1182271281 22:29155289-29155311 CTTTGGGAGGCCAAGGTAAGTGG + Intronic
1182506176 22:30784500-30784522 CTTTGAGAGGCCAAGGTAGTGGG - Intronic
1182791865 22:32959836-32959858 CTTTGGAAGGCCAAGGCAAAAGG - Intronic
1183146396 22:35996368-35996390 CTTTGAGAGGCCAAGGTGGTTGG + Intronic
1183561945 22:38581984-38582006 CTTTGGAAGGCCAAGGCAAGAGG - Intronic
1183701475 22:39453686-39453708 CTTTGAGAGGCCAAGGTAGGCGG - Intergenic
1183852501 22:40602593-40602615 CTTTGGGAGGCCAAGGTAGTTGG + Intronic
1183892289 22:40939702-40939724 CTGTGAAAGGGCCAGTTAAGAGG - Intergenic
1184053534 22:42027302-42027324 CTTTGGAAGGGCAATCTTATGGG + Exonic
1184480048 22:44741061-44741083 CTTTGAGAGGGCAAGGTGGGTGG + Intronic
1184575403 22:45360567-45360589 CTTTGGAAGGCCAAGGGAATAGG + Intronic
1184791089 22:46700480-46700502 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
1184848606 22:47104449-47104471 CTTTGGGAGGGCAAGGCAAGTGG + Intronic
1185087280 22:48747651-48747673 CTTTGAGAGGCCAAGGTGAGCGG + Intronic
1185265290 22:49899044-49899066 CTTTGGAAGGCCAAGGCAAGCGG + Intergenic
949145332 3:692664-692686 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
949164382 3:920594-920616 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
949172079 3:1012686-1012708 CTTTGGGAGGGCAAGGTAGGAGG + Intergenic
949382375 3:3460557-3460579 CTTTGGAAGGCCAAGGCAAGCGG + Intergenic
949543849 3:5055280-5055302 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
949714116 3:6908556-6908578 CTGTGAAAAGGCAAGCAAATAGG - Intronic
949764506 3:7511352-7511374 CTTTGAAGGGAGAAGGGAATAGG - Intronic
949892145 3:8741408-8741430 CTTTTAAGTAGCAAGGTAATAGG + Intronic
949939681 3:9145337-9145359 CTTTGGGAGGCCAAGGTAAGTGG - Intronic
949978513 3:9482906-9482928 CTTTGAGAGGCCAAGGTAGTTGG + Intergenic
950070909 3:10151819-10151841 CTTTGGAAAGCCAAGGTAAGAGG + Exonic
950192459 3:10987082-10987104 CTTTGAGAGGCCAAGGCAGTCGG + Intergenic
950254695 3:11494828-11494850 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
950285732 3:11743291-11743313 CTCTGAAAGGGCCAGAGAATGGG - Intergenic
950776482 3:15354795-15354817 CTTTGAAAGGCCAAGGCAGAAGG - Intergenic
950843643 3:15992683-15992705 CTTTGAGAGGCCAAGGAAAGAGG - Intergenic
950987310 3:17388603-17388625 CTTTGAAAGGTCAAGGCAGGAGG + Intronic
951047201 3:18053192-18053214 CTTTGAGAGGGCAAGGCAGGTGG - Intronic
951400098 3:22222210-22222232 CTTTGAGAGGCCAAGGCAAGTGG - Intronic
951884953 3:27515296-27515318 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
951888428 3:27547049-27547071 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
952434894 3:33263408-33263430 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
953512062 3:43552309-43552331 CTTTGGAAGGCCAAGGTGGTAGG + Intronic
953516967 3:43602825-43602847 ATTTGAAAGGGAAAGGTTAATGG - Intronic
953952843 3:47205633-47205655 CTTTGAGAGGCCAAGGTAAGTGG + Intergenic
954171234 3:48804215-48804237 CTTTGGAAGGCCAAGCTAAGTGG + Intronic
954347048 3:50008792-50008814 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
954393681 3:50280891-50280913 CTTTGAAAGGCCAAGGTGGCTGG - Intronic
954732243 3:52674236-52674258 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
954896433 3:53979112-53979134 CTTTGAGAGGCCGAGGTAGTAGG - Intergenic
955066005 3:55534173-55534195 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
955357069 3:58239904-58239926 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
955998661 3:64705089-64705111 CTTTGGAAGGCCAAGGTAGGCGG + Intergenic
956909378 3:73801646-73801668 CTTTGAAAGGAAAAGGAATTTGG - Intergenic
957185977 3:76941677-76941699 TTTTGAAAGGGAAAGTTACTGGG - Intronic
957663162 3:83186846-83186868 ATTTGAGAGGCCAAGGTAAGAGG - Intergenic
957807530 3:85169235-85169257 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
958049917 3:88332432-88332454 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
958133558 3:89459764-89459786 ATTTGAAAGGCCAAGGCAAGTGG - Intronic
958673202 3:97231573-97231595 CTTTGTAGGGGAAAGGAAATGGG + Intronic
958720914 3:97842317-97842339 CTTTGAAAGGCCAAGTTTAGAGG + Intronic
959274167 3:104256401-104256423 ATTTTAAATGTCAAGGTAATGGG - Intergenic
959335132 3:105054805-105054827 CTTTGAAAGGTCAAAGTGAAAGG - Intergenic
959365054 3:105447453-105447475 CTTTGAGAGGCCAAGGCAAGTGG + Intronic
959430568 3:106250581-106250603 CTTTGAGAGGGTAAGGCAAGAGG - Intergenic
959818348 3:110702898-110702920 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
959936130 3:112031324-112031346 CTTTGAAAGGCCAAGGGAGGAGG - Intergenic
959951401 3:112184392-112184414 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
960108444 3:113822297-113822319 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
960237581 3:115301642-115301664 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
960932234 3:122864768-122864790 CTTTGGGAGGCCAAGGCAATAGG + Intronic
961131587 3:124472444-124472466 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
961687540 3:128644713-128644735 CTTTGAGAGGCCAAGGTAGAAGG + Intronic
961796158 3:129410559-129410581 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
961915890 3:130374695-130374717 CTTTGGAAGGCCAAGGTGGTAGG - Intronic
961972742 3:130987572-130987594 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
962470966 3:135708286-135708308 CTTTGAAAGGCCGAGGTAGGAGG - Intergenic
962536755 3:136335745-136335767 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
962779848 3:138702316-138702338 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
963014084 3:140803824-140803846 CTTTGGAAGGCCAAGGTAAGTGG - Intergenic
963138655 3:141930159-141930181 CTTTGAAAGGCCAAGGCGAGTGG + Intergenic
963205795 3:142632840-142632862 CTTTGGAAGGCCAAGGCAAGTGG - Intronic
963461646 3:145621727-145621749 CTTTGAGAGGTCAAGGTAGGTGG + Intergenic
963786881 3:149544009-149544031 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
963819965 3:149879549-149879571 CTTTGGAAGGCCAAGGTAAAAGG - Intronic
963969118 3:151409711-151409733 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
964434981 3:156641916-156641938 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
964782563 3:160356762-160356784 CTTTGAGAGGCCAAGGCAGTAGG - Intronic
965056831 3:163729514-163729536 ATTTGAAAGGCCTAGGTACTAGG + Intergenic
965149034 3:164946647-164946669 CTTTGAGAGGCCAAAGTAAGTGG + Intergenic
965589025 3:170344832-170344854 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
965798901 3:172470845-172470867 CTTTGAATGGGCAAGGAACTTGG - Intergenic
965866568 3:173212120-173212142 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
966408686 3:179626478-179626500 CTTTGAGAGGCCAAGGTGAGCGG - Intronic
966409994 3:179637895-179637917 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
966609624 3:181855352-181855374 CTTTGGAAGGCCAAGGCAAGCGG - Intergenic
966795755 3:183712059-183712081 CTTTGGGAGGGCAAGGTAGGCGG - Intronic
967557452 3:190876307-190876329 CTTTGAAAGGCCAAGGCAAGCGG - Intronic
967887678 3:194344451-194344473 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
968823454 4:2874981-2875003 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
968863286 4:3190098-3190120 CTTTGGGAGGTCAAGGTAAAAGG + Intronic
969210312 4:5682245-5682267 CTTTGGAAGGCCAAGGCAAGTGG + Intronic
969400954 4:6955165-6955187 CTTTGAAAATGCAAGGGAAAAGG - Intronic
969571148 4:8009233-8009255 CTTTCAAAGGGCAAGGAACAAGG + Intronic
969682534 4:8651358-8651380 CTTTGAAAGGCCAAGGCAGAAGG - Intergenic
969795778 4:9527202-9527224 CTTTGAGAGGCCAAGGTGAGTGG - Intergenic
969985095 4:11200334-11200356 CTCTGAAAGTGCAGGGTAACAGG + Intergenic
970071847 4:12168670-12168692 CTTTGAAAGGCCAAGACAAGAGG + Intergenic
970363611 4:15335897-15335919 CTTTGCAAGGGCAAGAAAGTAGG + Intergenic
970371991 4:15417531-15417553 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
970448290 4:16141943-16141965 ATTTGAGAAGGCAAGGAAATGGG + Intergenic
971023919 4:22569105-22569127 CTTTGAGAGGCCAAGGCAAGTGG - Intergenic
971422636 4:26488178-26488200 CTCAGAAAGGGCAAGGGACTAGG + Intronic
971570639 4:28206300-28206322 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
971649513 4:29255177-29255199 CTTTGAGAGGCCAAGGCATTTGG + Intergenic
972287315 4:37661521-37661543 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
972531046 4:39961635-39961657 CTTTGGAAGGCCAAGGCAAGAGG - Intronic
972550622 4:40129712-40129734 CTTTGAGAGGCCAAGGTAGAAGG - Intronic
972620631 4:40745063-40745085 CTTTGAAAGGCCAAGTTTAGAGG - Intergenic
972647358 4:40981853-40981875 CTTTGAGAGGCCAAGGCAGTAGG + Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
972779236 4:42271602-42271624 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
973179930 4:47254613-47254635 CTTTGAGAGGCCAAGGCAAACGG - Intronic
973341935 4:49014207-49014229 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
973778526 4:54266488-54266510 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
973937806 4:55867229-55867251 CGTTGAAAGGACAAGGAGATCGG + Intronic
974054270 4:56970025-56970047 CTTTGGAAGACCAAGGTAAGTGG - Intronic
974401377 4:61412329-61412351 CTTTGGGAGGCCAAGGCAATAGG - Intronic
974422380 4:61694278-61694300 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
974816562 4:67012253-67012275 GTTTGAAAGGGGAGGGAAATGGG + Intergenic
975157815 4:71091189-71091211 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
975223810 4:71845889-71845911 CTTTGAGAGGCCAAGGTGAATGG - Intergenic
975552144 4:75624306-75624328 CTTTGAAAGGCCGAGGTAGGAGG + Intronic
975705139 4:77104324-77104346 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
976185207 4:82436440-82436462 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
976192890 4:82505288-82505310 CTTTGGAAGGTCAAGGTAGGAGG - Intronic
976421494 4:84849762-84849784 CTAAGAAAGGGAAAGGGAATGGG + Intronic
976705699 4:88016715-88016737 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
976934772 4:90616435-90616457 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
977419349 4:96778367-96778389 CTTTGGGAGGCCAAGGTAAGCGG + Intergenic
977530125 4:98191571-98191593 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
977530565 4:98195775-98195797 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
977642957 4:99377819-99377841 CTTTGAAAGGCCAAGGAGGTGGG - Intergenic
977774055 4:100896189-100896211 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
978547916 4:109892965-109892987 CTTTGAAAGGCCAAGGCAGAAGG + Intergenic
980030463 4:127823390-127823412 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
980700075 4:136414601-136414623 TTTTCAAAGGGCAAAATAATGGG - Intergenic
980884356 4:138746036-138746058 CTTTGAGAGGCCAAGGTGAGGGG + Intergenic
980902790 4:138920977-138920999 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
980915539 4:139030120-139030142 CTTTGAGAGGGCAAGGCAGGTGG - Intronic
980946610 4:139327178-139327200 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
980988206 4:139716002-139716024 CTTTGGGAGGGCAAGGCAAGCGG - Intronic
981103862 4:140858595-140858617 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981196572 4:141928143-141928165 CTTTCAGAGGACGAGGTAATAGG + Intergenic
981319992 4:143380662-143380684 CTTTGGGAGGGCAAGGAAAGAGG - Intronic
981438279 4:144751861-144751883 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
981922474 4:150100154-150100176 CTTTGGAAGGCCAAGGCAAGAGG - Intronic
981923013 4:150107617-150107639 CTTTCAGAGGCCAAGGTAAGTGG - Intronic
982002570 4:151034376-151034398 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
982238245 4:153272712-153272734 CTTTGGGAGGCCAAGGTAGTTGG - Intronic
982436747 4:155389019-155389041 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
982524805 4:156465424-156465446 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
982950469 4:161688324-161688346 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
983023359 4:162707249-162707271 ATATGAAAGGGTAAGGTAAGGGG + Intergenic
983028542 4:162768937-162768959 CTTTGAGAGGCCAAGGCAGTAGG + Intergenic
983203120 4:164883727-164883749 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
983651291 4:170039542-170039564 CTTTGGGAGGCCAAGGCAATAGG + Intergenic
983683296 4:170377466-170377488 CTTTGAAAGGACAAAGAAAATGG + Intergenic
983864894 4:172754325-172754347 CTTTGGAAGGCCAAGGTGGTTGG + Intronic
984239088 4:177195794-177195816 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
984899514 4:184572562-184572584 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
985113486 4:186569444-186569466 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
985125613 4:186691555-186691577 CTTTGGGAGGCCAAGGTAGTAGG + Intronic
985263031 4:188132529-188132551 CTTTGGAAGGTCAAGGTAGGAGG - Intergenic
985282734 4:188303008-188303030 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
985283721 4:188312811-188312833 CTTTGGGAGGCCAAGGCAATAGG - Intergenic
985869736 5:2544853-2544875 CTTTGGAAGGCCAAGGGAACAGG + Intergenic
985876091 5:2597016-2597038 CTTTGAGAGGCCAAGGCAAGCGG + Intergenic
986709398 5:10477684-10477706 CTTTGGGAGGCCAAGGCAATCGG + Intergenic
987350091 5:17014431-17014453 CTTTGGAAGGGCAAGGCAGGTGG + Intergenic
987691324 5:21270291-21270313 CTTTGGAAGGCCAAGGTTAGAGG - Intergenic
988080911 5:26414226-26414248 CTTTGGAAGGCCAAGGTAGATGG + Intergenic
988253639 5:28794844-28794866 CTTTGGAAAGTCAGGGTAATGGG - Intergenic
988282929 5:29173315-29173337 CTTTGAAAGGCCAAGGCAGACGG + Intergenic
988299548 5:29404354-29404376 CTTTGGAAAGGGAAGGTAAGAGG + Intergenic
988306981 5:29505450-29505472 CTTTGGAAGGGCAAGGTGCGTGG + Intergenic
988458629 5:31411868-31411890 CTTTGAAAGGTCAAGGTGGGTGG - Intronic
988509297 5:31852527-31852549 CTTTGGGAGGCCAAGGTAGTTGG - Intronic
988719068 5:33858411-33858433 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988773417 5:34453854-34453876 CTTTGGAAGGCCAAGGTGGTTGG + Intergenic
988863810 5:35312866-35312888 CTTTGGAAGGCCAAGGTAGGTGG - Intergenic
988895492 5:35668531-35668553 CTCTGAAAGGGCAACATGATGGG + Intronic
988924562 5:35976594-35976616 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
989063427 5:37433302-37433324 CTTTGTAAGGCCAAGGTAGGCGG - Intronic
989173474 5:38496640-38496662 CTGTGACTAGGCAAGGTAATTGG + Intronic
989391263 5:40903129-40903151 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
989487884 5:42013059-42013081 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
990102051 5:52202728-52202750 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
990256821 5:53979287-53979309 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
990522301 5:56591942-56591964 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
991251349 5:64565232-64565254 CTTAGAAAGGGTAAGCTAATAGG + Intronic
991379411 5:66004187-66004209 CTTTGGGAGGCCAAGGTATTCGG - Intronic
991396861 5:66213198-66213220 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
991623761 5:68575552-68575574 CTTTGGAAGGCCAAGGTAGAGGG - Intergenic
991694356 5:69256182-69256204 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
991709738 5:69397073-69397095 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
991728691 5:69561876-69561898 CTTTGAGAGGCCAAGGCAAAAGG - Intronic
991805121 5:70417023-70417045 CTTTGAGAGGCCAAGGCAAAAGG - Intergenic
991866263 5:71065999-71066021 CTTTGAGAGGCCAAGGCAAAAGG + Intronic
991867624 5:71079160-71079182 CTTTGAGAGGCCAAGGCAAGTGG - Intergenic
991902584 5:71475351-71475373 CTTTGGGAGGGCAAGGCAAGAGG - Intronic
991980949 5:72230136-72230158 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
992564046 5:77980585-77980607 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
992694101 5:79267656-79267678 CTTTGTGAGAGCAAGGTAAGAGG - Intronic
992694964 5:79276978-79277000 CTTTGGAAGGCCAAAGTAAGAGG - Intronic
992834835 5:80630019-80630041 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
992981811 5:82182986-82183008 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
993472979 5:88329320-88329342 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
993654864 5:90564989-90565011 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
993918783 5:93774017-93774039 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
994004287 5:94819372-94819394 CTTTGAGAGGCCGAGGCAATCGG - Intronic
994554629 5:101282869-101282891 CTTTCTATTGGCAAGGTAATAGG - Intergenic
994746703 5:103687046-103687068 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
995457577 5:112368406-112368428 GTATGAAAGGGCAAGCTAATGGG - Intronic
995667355 5:114557661-114557683 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
995873875 5:116770092-116770114 CTTTGGAAGGGCAAGGCAGGAGG + Intergenic
996292859 5:121874636-121874658 CTTTGGAAGGCCAAGGTAGGGGG + Intergenic
996505092 5:124259624-124259646 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
996728093 5:126690436-126690458 CTTTGATAGGCCAAGGCATTAGG + Intergenic
996856071 5:128008896-128008918 CTTTGGAAGGGCAAGGCAGGTGG + Intergenic
997161812 5:131616848-131616870 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
997317885 5:132953080-132953102 CTTTGGGAGGGCAAGGTGAGAGG + Intronic
997546330 5:134711217-134711239 CTTTGAGAGGCCAAGGTAGAAGG + Intronic
997566896 5:134894928-134894950 CTTTGAGAGGCCAAGGTAGAAGG + Intronic
997604166 5:135162173-135162195 CATTGAAAGGGCTAGAAAATGGG - Intronic
997946967 5:138211416-138211438 CTTTGAGAGGCCAAGGTAGGTGG + Intronic
998011702 5:138700361-138700383 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
998488849 5:142528335-142528357 CTTTGAGAGGCCAAGGCAAGGGG + Intergenic
998841195 5:146256097-146256119 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
998884218 5:146677184-146677206 TTTTGAACTGGCAAGATAATTGG + Intronic
999185244 5:149702603-149702625 CTTTGGGAGGGCAAGGTGAGGGG - Intergenic
999404653 5:151296315-151296337 CTGTGAGAGGGCCAGGGAATGGG - Intronic
999555798 5:152741131-152741153 CTTGGAAAGGGCAAGGGGTTAGG + Intergenic
999741146 5:154553657-154553679 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
999968739 5:156837660-156837682 CTTTGAGAGGCCAAGGTGAGTGG - Intergenic
1000070928 5:157740508-157740530 CTCTGAAGGGGGAAGGTAGTGGG + Exonic
1000318676 5:160117214-160117236 CTTTGGAAGGCCAAGGCAGTAGG + Intronic
1000336733 5:160246838-160246860 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
1000351204 5:160354332-160354354 CTTTGGAAGGGCGAGGTAGATGG + Intronic
1000819322 5:165964376-165964398 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1000857608 5:166418717-166418739 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
1001526422 5:172431931-172431953 CTTTGAGAGGCCAAGGTGAGCGG + Intronic
1001840279 5:174870411-174870433 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1001887574 5:175309284-175309306 CAGTGAAAGGGCAAGGTATCTGG - Intergenic
1001909488 5:175503757-175503779 CTTTGAGAGGCCAAGGCAAGTGG + Intronic
1002289126 5:178187720-178187742 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
1002693529 5:181068514-181068536 CTTTGGAAGGCCAAGGTGAGCGG + Intergenic
1003341036 6:5221068-5221090 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1003866875 6:10371551-10371573 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1003876072 6:10438320-10438342 CTTTGAGAGGCCAAGGTGAAAGG + Intergenic
1003958991 6:11191761-11191783 CTTTGGGAGGCCAAGGTAGTAGG + Intronic
1004102782 6:12631617-12631639 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1004212896 6:13670044-13670066 CTTTGAAAGGCCAAGGTGGTGGG + Intronic
1004300356 6:14452152-14452174 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1004962085 6:20801165-20801187 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1005115294 6:22329387-22329409 CTTTGGAAGGCCAAGGCAAGTGG - Intergenic
1005148677 6:22722439-22722461 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1005271995 6:24176047-24176069 CTTTGAGAGGTCAAGGCAAGAGG + Intronic
1005361199 6:25032590-25032612 ATTTTAAAGGTCAGGGTAATCGG - Intronic
1005397621 6:25399384-25399406 CTTTGACTGGGGAAGCTAATAGG + Intronic
1006018344 6:31101387-31101409 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
1006083136 6:31579025-31579047 CTTTGCAAGGCCAAGGTGAGAGG + Intergenic
1006220512 6:32485590-32485612 CTTTGAAAGGCCAAGGCAGGCGG + Intergenic
1006328367 6:33371524-33371546 CTTTGGAAGGCCAAGGCAAGTGG + Intergenic
1006885441 6:37378048-37378070 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
1007638457 6:43315921-43315943 CTTTGAGAGGCCAAGGTGAGTGG - Intronic
1008458106 6:51735680-51735702 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1008512544 6:52290251-52290273 CTTTGAGAGGGCAAGGCAGGTGG + Intergenic
1008522522 6:52375765-52375787 CTTTGGAAGGCCAAGGCAGTAGG - Intronic
1008780412 6:55096511-55096533 CTTTGAGAGGCCAAGGCAAAAGG - Intergenic
1008802876 6:55391505-55391527 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1008910054 6:56722269-56722291 ATTTGCCAGGGCAAGGCAATTGG - Intronic
1008937052 6:57003255-57003277 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1008939933 6:57035858-57035880 CTTTGGGAGGCCAAGGTAGTAGG + Intergenic
1008971679 6:57375961-57375983 CTTTGAGAGGGCAAGGGAGTAGG + Intronic
1009160598 6:60277471-60277493 CTTTGAGAGGGCAAGGGAGTAGG + Intergenic
1009422337 6:63477775-63477797 CTTTGAAAGGCCAAGGAAGGAGG - Intergenic
1009609182 6:65916881-65916903 CTTTGGAAGGCCAAGGTGAAAGG - Intergenic
1009934191 6:70214044-70214066 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1009962910 6:70545367-70545389 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010219285 6:73433728-73433750 CTTTGGAAGGCCAAGGTGAGTGG - Intronic
1010401381 6:75450219-75450241 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1010413714 6:75589737-75589759 CTTTGGAAGGCCAAGGTGAGCGG - Intergenic
1010425760 6:75727314-75727336 CTTTGGGAGGCCAAGGTAAAAGG + Intergenic
1010743491 6:79535592-79535614 CTTTGGCAGGGAAAGGTGATGGG + Intronic
1011051452 6:83155216-83155238 CTTTGACAGGCCAAGGCACTAGG + Intronic
1011564971 6:88664566-88664588 CCCTGAAAGGACAAGGGAATGGG + Intronic
1011579245 6:88840640-88840662 CTTTGGAAGGCCAAGGCACTTGG - Intronic
1011904326 6:92343288-92343310 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1012019660 6:93902726-93902748 CTTTGAGAGGCCAAGGTGGTTGG - Intergenic
1012959790 6:105610182-105610204 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1013036814 6:106393016-106393038 CTTTGAGAGGCCAAGGTGAGCGG - Intergenic
1013276188 6:108587052-108587074 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1014028407 6:116674465-116674487 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1014221580 6:118803731-118803753 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1014235980 6:118955341-118955363 ATTTAAAAGGGCTAAGTAATGGG - Intergenic
1014427718 6:121329403-121329425 CTTTGGAAGGCCAAGGTGGTGGG + Intronic
1015017745 6:128434774-128434796 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1015174542 6:130292528-130292550 CTTTGAGAGGCCAAGGCAAGTGG - Intronic
1015183358 6:130384553-130384575 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1015246536 6:131080916-131080938 CTTCGAGAGGCCAAGGTAAGAGG + Intergenic
1015504952 6:133974568-133974590 CTTTGGGAGGGCAAGGTGAGTGG - Intronic
1015558761 6:134492123-134492145 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1015568268 6:134595857-134595879 CTTTGAGAGGCCAAGGTGAGCGG + Intergenic
1015763945 6:136695380-136695402 CTTTGAGAGGCCAAGGTGGTCGG - Intronic
1015803767 6:137088302-137088324 CTTTGAGAGGTCAAGGCAGTTGG + Intergenic
1015969204 6:138727551-138727573 CTTTGGGAGGGCAAGGCAGTTGG + Intergenic
1016076105 6:139797403-139797425 CTTTGAAAGGCCAAGGTAGGTGG - Intergenic
1016137518 6:140563110-140563132 CTTTGGGAGGGCAAGGTAGGTGG - Intergenic
1016210022 6:141520818-141520840 CTTTGGGAGGCCAAGGCAATAGG + Intergenic
1016234954 6:141853630-141853652 CTTAGAAAAGGAAAGTTAATGGG + Intergenic
1016406668 6:143738512-143738534 CTTTGGGAGGCCAAGGTAAATGG + Intronic
1016917998 6:149263046-149263068 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1017111146 6:150933858-150933880 CTTTGGGAGGCCAAGGTAAAAGG - Intronic
1017803527 6:157922024-157922046 CATTGTAAGGGCAACGTGATCGG - Intronic
1017809722 6:157976284-157976306 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1017917532 6:158843413-158843435 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1018702631 6:166439349-166439371 CATTGAAAGGCCAAGGCAGTTGG - Intronic
1020022266 7:4876230-4876252 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1020032922 7:4945507-4945529 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1020039743 7:4992961-4992983 CTTTGACAGGCCAAGGCAAGAGG - Intronic
1020235692 7:6353590-6353612 CTTTGAGAGGCCAAGGCAGTAGG + Intergenic
1020237262 7:6366020-6366042 CTTTGAAAGGGCGAGGTGGGTGG + Intergenic
1020322039 7:6946297-6946319 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1020387584 7:7624873-7624895 CTTTGAAAGGCTAAGGCAGTTGG - Intergenic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1020754061 7:12179043-12179065 TTTTGAAAGGGGAAGTTTATTGG + Intergenic
1020793571 7:12656678-12656700 CTTTGAAAGGCCAAGGCGGTTGG + Intergenic
1020807406 7:12807634-12807656 CTTTGGAAGGGCAAGGCAGGTGG - Intergenic
1021236360 7:18147400-18147422 CTTTTAATTGGCAAGTTAATAGG + Intronic
1021245517 7:18256842-18256864 CTTTGGGAGGGCAAGGTAGGGGG + Intronic
1021568341 7:22037202-22037224 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
1021702690 7:23335518-23335540 CTTTGGGAGGCCAAGGTAAGAGG - Intronic
1022725119 7:32974257-32974279 CTTTGGAAGGCCAAGGCAAGAGG - Intronic
1022919008 7:34993814-34993836 CTTTGGAAGGCCAAGGCAAGTGG + Intronic
1023202478 7:37713393-37713415 CTTTGAGAGGCCAAGGTAGAAGG - Intronic
1023393950 7:39734996-39735018 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
1023437781 7:40156218-40156240 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
1023573538 7:41599127-41599149 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1023979418 7:45058986-45059008 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1024080532 7:45851892-45851914 CTTTGAGAGGCCAAGGTAGGTGG + Intergenic
1024212784 7:47219825-47219847 TTTTGAAAGAACAGGGTAATGGG + Intergenic
1024577500 7:50776462-50776484 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1024727517 7:52215119-52215141 CTTTGGAAGGCCAAGGCAGTTGG - Intergenic
1024769774 7:52707167-52707189 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1025048481 7:55713587-55713609 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1025064770 7:55843889-55843911 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1025076869 7:55951384-55951406 CTTTGAAAGGCCAAAGTGGTTGG + Intergenic
1025098172 7:56113712-56113734 CTTTGAGAGGCCAAGGTGAGTGG + Intergenic
1025140877 7:56462703-56462725 TTTGGAAAGGGCCAGGCAATGGG - Intergenic
1025163656 7:56690568-56690590 TTTGGAAAGGGCCAGGCAATGGG + Intergenic
1025290163 7:57712296-57712318 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1025612659 7:63091515-63091537 TTTGGAAAGGGCCAGGCAATGGG + Intergenic
1025706619 7:63871584-63871606 TTTGGAAAGGGCCAGGCAATGGG - Intergenic
1025944110 7:66093071-66093093 CTTTGGAAGGGCAAGGTGCGAGG + Exonic
1026277366 7:68891792-68891814 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
1026303716 7:69122019-69122041 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1026329833 7:69342248-69342270 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1026433062 7:70367311-70367333 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1026454580 7:70559575-70559597 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1026460443 7:70610240-70610262 CTTTGAGAGGTCAAGGCAGTTGG - Intronic
1026584372 7:71644291-71644313 CTTTGGAAGGTCAAGGTGAGCGG + Intronic
1026689514 7:72539874-72539896 CTTTGAGAGGCCAAGGTTAGAGG + Intergenic
1026748571 7:73031867-73031889 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1026752219 7:73060012-73060034 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1026755870 7:73088139-73088161 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1026915427 7:74117259-74117281 CTTTGAAAGGTCAAGGCAGGAGG - Intronic
1027034767 7:74917134-74917156 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1027091536 7:75305290-75305312 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
1027095179 7:75333256-75333278 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
1027324159 7:77034413-77034435 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1027485923 7:78761699-78761721 CTTTGGGAGGCCAAGGTAAGTGG - Intronic
1027785351 7:82573449-82573471 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1027917967 7:84350320-84350342 CTTTGCAGGGGCTAGGGAATGGG + Intronic
1029020495 7:97359837-97359859 CTTTGAAAGGCCAAGGCAGATGG - Intergenic
1029176291 7:98667058-98667080 CTTTGGGAGGCCAAGGTAAGCGG + Intergenic
1029716493 7:102330235-102330257 CTTTGGAAGGGCAAGGCAGGTGG + Intergenic
1029793203 7:102867108-102867130 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
1029806259 7:103000267-103000289 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1029867530 7:103650866-103650888 CTTTGGGAGGCCAAGGTAAGGGG - Intronic
1029878788 7:103783236-103783258 CTTTGAGAGGGCAAGGTGGGAGG - Intronic
1030201837 7:106913779-106913801 CTTTGAGAGGCCAAGGTGAAAGG - Intergenic
1030403332 7:109080254-109080276 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1030539072 7:110806502-110806524 CTGTTAAAGTGCAAGATAATAGG - Intronic
1030821275 7:114094913-114094935 CATTTAAGGGGCAAGGGAATGGG - Intronic
1031552685 7:123134134-123134156 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1031570110 7:123348820-123348842 CTTCCAAAGGGCAAGCAAATAGG - Intergenic
1032031203 7:128485287-128485309 CTTTGGAAGGCCAAGGAGATAGG + Intronic
1032056571 7:128689168-128689190 CTTTGGAAGGCCAAGGTAGGCGG - Intergenic
1032209937 7:129904361-129904383 CTTTGGAAGGCCAAGGCAAGAGG - Intronic
1032213497 7:129938165-129938187 CTTTGGAAGGCCAAGGCAAGAGG + Intronic
1033115016 7:138617603-138617625 CTTTGAAAGGCCAAGGTAGGAGG + Intronic
1033454967 7:141494658-141494680 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1034040918 7:147875646-147875668 CTTTGGGAGGCCAAGGTAGTAGG + Intronic
1034057641 7:148052801-148052823 CTTTGAGAGGCCAAGGTGAGCGG + Intronic
1034095902 7:148407458-148407480 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034247572 7:149659542-149659564 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1034604477 7:152299074-152299096 CTTTGGGAGGCCAAGGTAAGCGG + Intronic
1034616202 7:152418948-152418970 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034854737 7:154532552-154532574 CTTTGAAAGGTCAATAAAATTGG + Intronic
1034914789 7:155028209-155028231 CTTTGAGAGGCCAAGGCAAGAGG + Intergenic
1035199519 7:157252169-157252191 CTCTGATCAGGCAAGGTAATTGG + Intronic
1035845731 8:2862224-2862246 TTTTGAGTGGGCAAGTTAATGGG + Intergenic
1036084300 8:5597383-5597405 CTTTGAGAGGCCGAGGTAAGAGG + Intergenic
1036125496 8:6058126-6058148 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1036150761 8:6296085-6296107 CTTTGGAAGGCCAAGGTCAGTGG + Intergenic
1036393685 8:8348158-8348180 CTTTGAAAGGCCAAGGCAGGTGG - Intronic
1036425847 8:8644657-8644679 CTTTGGAAGGTCAAGGCAAGAGG + Intergenic
1036452010 8:8877054-8877076 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
1036921048 8:12855681-12855703 CTCTGAAAGGCCAAGGCAGTGGG - Intergenic
1036977121 8:13426054-13426076 CTTTGAGAGGGCAAGGCAGGAGG - Intronic
1037311686 8:17562895-17562917 CTTTGAAAGGCCAAGGCAGGAGG + Intronic
1037825653 8:22159168-22159190 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1038111448 8:24504122-24504144 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
1038174921 8:25173034-25173056 CTTTGAGAGGCCAAGGTTAGGGG + Intergenic
1038279961 8:26155022-26155044 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1038343475 8:26709593-26709615 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1038354466 8:26814503-26814525 CTTTGGGAGGCCAAGGTGATAGG - Intronic
1038843319 8:31206061-31206083 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1038995297 8:32916419-32916441 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1039080977 8:33733660-33733682 CTTTGGAAGGACAAGGCAAGAGG - Intergenic
1039232716 8:35465954-35465976 CCTGGAAAAGGCAAGGAAATAGG + Intronic
1039331705 8:36544497-36544519 CTTTGGAAGGCCAAGGTAGGGGG + Intergenic
1039639006 8:39198619-39198641 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1039670997 8:39598522-39598544 CTTTGAAAGGCCAAGGCAGGTGG + Intronic
1040074779 8:43218547-43218569 CTTTGAAAGGCCAAGGTAGGTGG - Intergenic
1040858940 8:51979198-51979220 CTTTGAAAGGCCAAGGCGAGTGG - Intergenic
1041148972 8:54911937-54911959 CTTTGAGAGGCCAAGGTGAGAGG - Intergenic
1041228606 8:55726715-55726737 CTTTGAGAGGTCAAGGTGAGTGG + Intronic
1041234908 8:55790760-55790782 CTTTGGAAGGCCAAGGCAAGTGG - Intronic
1041935783 8:63330400-63330422 CTTTGAGAGGCCAAGGTAGGAGG + Intergenic
1041964133 8:63654988-63655010 TTTAGAAATGCCAAGGTAATGGG - Intergenic
1042112639 8:65397043-65397065 CTTTGAGAGGCCAAGGTGGTAGG + Intergenic
1042215455 8:66426501-66426523 CTTTGAAAGGCCAAGGTAGGTGG + Intergenic
1042236553 8:66618981-66619003 CTTTGGAAGGCCAAGGTGGTAGG - Intergenic
1042252374 8:66769813-66769835 CTTTGAGAGGCCAAGGTAAGAGG - Intronic
1042599844 8:70488202-70488224 CTTTGGAAGGCCAAGGTAGGAGG + Intergenic
1042829536 8:73011302-73011324 CTTTGGAAGGCCAAGGCAGTTGG + Intronic
1043507951 8:80921423-80921445 CTTTGGAAGGTCAAGGTGAGCGG + Intergenic
1043760330 8:84060701-84060723 CTTTGGGAGGCCAAGGTAAATGG - Intergenic
1043925936 8:86037193-86037215 CTTTGGAAGGCCAAGGTCATAGG + Intronic
1044241028 8:89888832-89888854 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1044572655 8:93736960-93736982 CTTTGCAAGGCCAAGGCAAGAGG + Intronic
1044687439 8:94840798-94840820 CTTTGGAAGGCCAAGGTAGGTGG - Intronic
1044738597 8:95303333-95303355 CTTTGAAAGGTGATGGTATTAGG - Intergenic
1044935111 8:97286497-97286519 CTTTGAGAGGTCAAGGTAGGTGG - Intergenic
1044962585 8:97545379-97545401 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1044984894 8:97748611-97748633 CTTTGGAAGGCCAAGGTAGGTGG + Intergenic
1045179314 8:99762892-99762914 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1045313680 8:101025680-101025702 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1045363017 8:101450251-101450273 GTTTGGAAGGGCATGGTACTGGG + Intergenic
1045369800 8:101511590-101511612 CTTTGGAAGGCCAAGGCAACGGG - Intronic
1045582433 8:103496576-103496598 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1045650394 8:104336920-104336942 CTTTGTGAGGCCAAGGTAAGAGG - Intronic
1046094032 8:109537402-109537424 CTTTGAAAGGGGAGAGTAAGTGG + Intergenic
1046596942 8:116272431-116272453 CTTTGTCAGGGCAAGGGAAGTGG + Intergenic
1046653710 8:116870281-116870303 CTTTGGGAGGCCAAGGTAAGAGG + Intronic
1046698059 8:117364829-117364851 CTTTGAGAGGCCAAGGCAAGAGG - Intergenic
1046721252 8:117621257-117621279 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1046886719 8:119375676-119375698 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1046926041 8:119790190-119790212 CTTTGAGAGACCAAGGTAAGTGG + Intronic
1046941082 8:119932226-119932248 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1047270975 8:123358587-123358609 CTTTGAGAGGTCAAGGTAGGTGG - Intronic
1047412376 8:124634389-124634411 CTTTGAAAGGCCAAGGCAGGAGG - Intronic
1047620209 8:126598576-126598598 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
1047748919 8:127865608-127865630 GTTGGAAAAGGCAAGGAAATAGG + Intergenic
1048447344 8:134501663-134501685 CTTTGAAGGGGAAAGGTGAGTGG + Intronic
1048875766 8:138836025-138836047 CTTTGGAAGGCCAAGGTAGGTGG + Intronic
1049120374 8:140731649-140731671 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1049776347 8:144407436-144407458 CTTTGGAAGGCCAAGGTGAGTGG + Intronic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1050108662 9:2192140-2192162 ATTTCAAAAGGCAAGGTATTAGG - Intronic
1050315737 9:4398928-4398950 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1050325547 9:4493657-4493679 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1050372280 9:4934064-4934086 CTTTGGAAGGGCAAGGCAAGAGG - Intergenic
1050605047 9:7292208-7292230 CTTTGGAAGGCCAAGGTGGTTGG - Intergenic
1050931712 9:11336779-11336801 CTTTGACAGGCCAAGGTAGGAGG - Intergenic
1051048680 9:12905887-12905909 CTTTGGGAGGCCAAGGTAACTGG + Intergenic
1051532739 9:18122980-18123002 CTTTGGGAGGCCAAGGTATTTGG - Intergenic
1051686778 9:19666160-19666182 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
1051864508 9:21664442-21664464 CTTTGGAAGGGCAAGGCCAGAGG + Intergenic
1052029691 9:23614356-23614378 CTTTGAAAGGCCAAGGTGGGGGG + Intergenic
1052235799 9:26212395-26212417 CTTTGGAAGGCCAAGGTGAGTGG - Intergenic
1052289195 9:26823324-26823346 CTTTGGGAGGCCAAGGTAAGAGG + Intergenic
1052305145 9:27000065-27000087 ATTTGAAAGGCCAGGGTAAGTGG - Intronic
1052427373 9:28323354-28323376 CTTTGAGAGGCCAAGGTGAGTGG + Intronic
1052749598 9:32476250-32476272 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1052839180 9:33276949-33276971 CTTTGGAAGGCCAAGGTAGGCGG + Intronic
1052870962 9:33506191-33506213 CTTTGGAAGGCCAAGGCAGTAGG + Intergenic
1053061925 9:35038719-35038741 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1053108749 9:35438429-35438451 CTTTGACAGTGAAAAGTAATGGG - Intergenic
1053362492 9:37499182-37499204 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
1053752166 9:41267507-41267529 CTTTGAGAGGCCAAGGTGAGCGG - Intergenic
1053908276 9:42868156-42868178 CTTTGAGAGGCCAAGGTAGGTGG - Intergenic
1054257692 9:62831839-62831861 CTTTGAGAGGCCAAGGTGAGCGG - Intergenic
1054333628 9:63783884-63783906 CTTTGAGAGGCCAAGGTGAGCGG + Intergenic
1054990311 9:71318004-71318026 TTTTGAAAGGCCAAGGCAAGAGG + Intronic
1055150188 9:72987791-72987813 CTTTGAGAGGCCAAGGCAAGTGG - Intronic
1055276700 9:74625368-74625390 CTTTGGGAGGGCAAGGCAAGCGG + Intronic
1055323458 9:75104299-75104321 CTTTGGAAGGACAAGGCAAGAGG + Intronic
1055560315 9:77515718-77515740 CTTTGGAAGGCCAAGGTAGGAGG + Intronic
1055956484 9:81778468-81778490 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1056345259 9:85687844-85687866 CTTTGGGAGGCCAAGGTAAGTGG + Intronic
1056448335 9:86688536-86688558 CTTTGAGAGGCCAAGGTAGGAGG - Intergenic
1056785159 9:89587060-89587082 CTTTGAAAGGCCGAGGCAGTTGG - Intergenic
1056989888 9:91400885-91400907 CTTTGAAAGGACAAGGCAGAAGG - Intergenic
1057100918 9:92359190-92359212 CTTTGAAAGGCCAAGGCAGGCGG - Intronic
1057289421 9:93792683-93792705 CTTTGAGAGGTCAAGGTAGGAGG - Intergenic
1057320770 9:94010619-94010641 CTTTGAGAGGCCAAGGTGGTCGG - Intergenic
1057339436 9:94186181-94186203 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1057611232 9:96545559-96545581 CTTTGGAAGGCCAAGGTAGGTGG - Intronic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1057755634 9:97832769-97832791 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1057883852 9:98813741-98813763 CTTTGAGAGGCCAAGGTAGGTGG - Intronic
1058044227 9:100338645-100338667 CTTTGGGAGGCCAAGGTAGTGGG + Intronic
1058245649 9:102621578-102621600 CTTTGGAAGGCCAAGGTGAGCGG - Intergenic
1058297231 9:103324310-103324332 CTTTGGGAGGCCAAGATAATAGG - Intergenic
1058398344 9:104582604-104582626 CTTTGGAAGGCCAAGGTGAGAGG + Intergenic
1058585749 9:106504594-106504616 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1058759120 9:108112841-108112863 CTTTGGAAGGCCAAGGTAGGGGG - Intergenic
1058986408 9:110212161-110212183 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1059098705 9:111447871-111447893 CTGTGAAAGGACAAGGGAAAAGG - Intronic
1059316961 9:113434058-113434080 CTTTGGGAGGCCAAGGCAATAGG - Intergenic
1059401581 9:114073740-114073762 CTTTGAGAGGCCAAGGCAAGAGG - Intronic
1060119769 9:120977661-120977683 CTTTGGAAGGCCAAGGTAGGAGG - Intronic
1060163541 9:121389187-121389209 CTTTGAGAGGCCAAGGCAGTTGG - Intergenic
1060340470 9:122771147-122771169 CTTTGAAAGGCCAAGGCAGGTGG + Intergenic
1060622261 9:125078281-125078303 CTTTGGAAGGCCGAGGTAAGCGG + Intronic
1060949943 9:127595105-127595127 CTTTGAAAGGTCAAGGTGAGAGG - Intergenic
1061123334 9:128657844-128657866 CTTTGGAAGGCCAAGGCAAGAGG + Intergenic
1061646980 9:132011556-132011578 CTTTCAAAGGTCAAGGTGAGAGG + Intronic
1061962632 9:133995867-133995889 CTTATAAAAGGCAATGTAATCGG + Intergenic
1062007327 9:134246628-134246650 CTTTGAAAGGCCAAGGCAGTTGG + Intergenic
1062304130 9:135892923-135892945 CTTTGAGAGGCCAAGGTAGGAGG + Intronic
1185800383 X:3005290-3005312 CTTTGAGAGGCCAAGGCAAGTGG - Intergenic
1186641819 X:11463582-11463604 CTTTGAGAGGCCAAGGCAAAGGG - Intronic
1187092459 X:16111192-16111214 CTTTGAGAGGCCAAGGTGAGTGG - Intergenic
1187345604 X:18460742-18460764 CTTTGGAAGGCCAAGGTGAGAGG - Intronic
1187386496 X:18853338-18853360 CTTTGAGAGGCCAAGGCAAGCGG - Intergenic
1187940549 X:24376687-24376709 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1189246689 X:39568738-39568760 GCTAGAAAGGGCAAGGAAATAGG - Intergenic
1189285166 X:39847106-39847128 CTTTGAGAGGCCAAGGTGAGAGG + Intergenic
1189542012 X:42001758-42001780 CTTTGGAAGGCCAAGGCAAGAGG - Intergenic
1189823087 X:44889256-44889278 CTTTGGGAGGCCAAGGTAAGTGG - Intronic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1190356084 X:49606444-49606466 CTTTGAAAGGCCAAGGAGAGTGG - Exonic
1190626268 X:52341305-52341327 CTTTGGAAGGCCAAGGTGAGAGG - Intergenic
1190627365 X:52349733-52349755 CTTTGAAAGGCCAAGGCAAGCGG - Intergenic
1190722136 X:53158284-53158306 CTTTGAAAGGACAGGGCAGTGGG - Intergenic
1190809676 X:53871096-53871118 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1191744090 X:64466692-64466714 CTTTGAGAGGCCAAGGTGAGAGG - Intergenic
1192375848 X:70560990-70561012 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1192402545 X:70850824-70850846 CTTTGAGAGGCCAAGGTGAGAGG + Intronic
1192415976 X:70981151-70981173 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1192431368 X:71114350-71114372 CTTTGGAAGGCCAAGGTGAGTGG + Intergenic
1193418430 X:81253460-81253482 CTTTGAGAGGCCAAGGTGAGAGG - Intronic
1193424736 X:81328173-81328195 GTTAGAAAGGCCAAGGCAATAGG + Intergenic
1194355631 X:92881027-92881049 CTTTGCAAGGCCAAGGCAAGAGG + Intergenic
1194589016 X:95773482-95773504 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1195307285 X:103596447-103596469 CTTTGGAAGGCCAAGGTAGGAGG - Intergenic
1195317705 X:103694931-103694953 CTTAGAAAGGGGAAAGTAATGGG - Intergenic
1195372990 X:104198335-104198357 CTTTGGGAGGCCAAGGTAAGAGG - Intergenic
1195497680 X:105556207-105556229 TTTAGAAAGGCCAAGGGAATAGG - Intronic
1195874687 X:109527184-109527206 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1196205758 X:112937513-112937535 CTTTGAAAGGCCAAGGCAGGAGG + Intergenic
1196649910 X:118158103-118158125 CTTTGAAAGGCCAAGGCAGGAGG - Intergenic
1197307053 X:124855662-124855684 CTCTGAAAGTGCAGGGTAACAGG + Intronic
1197732876 X:129826948-129826970 CTTTGGAAGGCCAAGGTGAGAGG + Intronic
1197849308 X:130840621-130840643 CTTTGAGAGGGCAAGGCATGTGG + Intronic
1198374339 X:136023052-136023074 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1198402764 X:136283610-136283632 CTTTGACAGGCCAAGGTAGAAGG - Intergenic
1198421870 X:136476447-136476469 CTTTTACAGGGCAAGGGTATTGG - Intergenic
1198427785 X:136537124-136537146 CTTTGAGAGGCCAAGGCAAGAGG + Intronic
1198560499 X:137844917-137844939 CTTTGCAAGGCCAAGGGAAGTGG + Intergenic
1198610708 X:138396482-138396504 CTTTGAGAGGCCAAGGCAAAAGG - Intergenic
1198628684 X:138609094-138609116 CTTTGGGAGGGCAAGGCAAAAGG - Intergenic
1198728084 X:139697894-139697916 CTTTGGAAGGTCAAGGTAGGAGG + Intronic
1199342440 X:146697047-146697069 TTTTGGAAGGCCAAGGTAAGAGG + Intergenic
1199370505 X:147042434-147042456 CTTTGCTAGGGCAATGTAAAAGG + Intergenic
1199509439 X:148604499-148604521 CTTTGAGAGGCCAAGGTAGGAGG - Intronic
1199802508 X:151265606-151265628 CTTTGAAAGGCCAAGGCAGGTGG - Intergenic
1199948114 X:152683309-152683331 CTTGGGATGGGCAAGGTGATTGG - Intergenic
1199961565 X:152785145-152785167 CTTGGGATGGGCAAGGTGATTGG + Intergenic
1200419261 Y:2946191-2946213 CTTTGGGAGGCCAAGGTGATTGG - Intronic
1200663978 Y:5998018-5998040 CTTTGCAAGGCCAAGGCAAGAGG + Intergenic
1200949526 Y:8880880-8880902 CTTTGGGAGGCCAAGGTAAGTGG + Intergenic
1201271720 Y:12262081-12262103 CTTTGAGAGTGCATGGTAGTAGG + Intergenic
1201684925 Y:16690446-16690468 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic