ID: 1178282026

View in Genome Browser
Species Human (GRCh38)
Location 21:31291910-31291932
Sequence CTGAAGAAGGAGAGTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 476}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178282026_1178282029 4 Left 1178282026 21:31291910-31291932 CCTTCCAGACTCTCCTTCTTCAG 0: 1
1: 0
2: 1
3: 34
4: 476
Right 1178282029 21:31291937-31291959 AATCCCTCTTTCTCACCTCCTGG 0: 1
1: 0
2: 2
3: 21
4: 261
1178282026_1178282030 5 Left 1178282026 21:31291910-31291932 CCTTCCAGACTCTCCTTCTTCAG 0: 1
1: 0
2: 1
3: 34
4: 476
Right 1178282030 21:31291938-31291960 ATCCCTCTTTCTCACCTCCTGGG 0: 1
1: 0
2: 3
3: 24
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178282026 Original CRISPR CTGAAGAAGGAGAGTCTGGA AGG (reversed) Intronic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901210326 1:7520849-7520871 CTGAGGAAGGCTGGTCTGGAAGG - Intronic
901366076 1:8749766-8749788 CAGCAGAATGAGAATCTGGAGGG + Intronic
901762706 1:11480873-11480895 CTGAAAATGGAGATTCTGTAAGG - Intronic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902316522 1:15623963-15623985 CTGAAGCAGGAGAACCTGGGAGG + Intronic
902791346 1:18770330-18770352 CCGAGGAAGGAGAGTAGGGAGGG - Intergenic
903183264 1:21615703-21615725 CTGAAGAAGTGCAGACTGGAGGG - Intronic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
903287911 1:22288416-22288438 GTCAAGAAGGAGCGTGTGGAAGG + Intergenic
903558625 1:24211388-24211410 ATGAAGAAAGTGAGTCCGGAGGG + Intergenic
904076891 1:27850087-27850109 CTGTAGAAGAAGCGTGTGGAGGG + Exonic
904402968 1:30268934-30268956 CTGAAGAAGGACAGACTCCAGGG + Intergenic
904405850 1:30287441-30287463 CTGGTGAAGAAGAGTCTGGCAGG + Intergenic
904827176 1:33281173-33281195 CTGAGGATGGAAAGTATGGAGGG + Intronic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905569451 1:38991816-38991838 CTGGGGGAGGAGAGCCTGGAGGG + Intronic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
906523047 1:46478577-46478599 CTGAAGAAGGCTAGACTTGATGG + Intergenic
906552285 1:46674970-46674992 CTGAAGAAGCAAAGGCTGCAGGG - Intergenic
906672419 1:47666043-47666065 AGGAAGAGGGAGTGTCTGGAGGG - Intergenic
907052800 1:51341070-51341092 CTGAGGCAGGAGAACCTGGAAGG + Intronic
907216795 1:52870760-52870782 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
908138110 1:61154252-61154274 CTGAGGTAGGAGAATCTGGGAGG - Intronic
908163709 1:61436997-61437019 CTGAGGAAGGAGGGTGTTGAGGG - Intronic
908992596 1:70111230-70111252 CTGAAGAAGAAAAGAGTGGATGG - Intronic
910496333 1:87832877-87832899 CAGAAAAAGAATAGTCTGGAGGG + Intergenic
912718999 1:112004065-112004087 CTGGAGCTGGAGAGCCTGGAGGG - Intergenic
912962169 1:114206017-114206039 ATAAAGCAGGAGAGTGTGGAGGG + Intergenic
912979031 1:114354004-114354026 CAGAAGATGGAGATTCTGAATGG + Intergenic
915086060 1:153389857-153389879 CTCAAGATGGAGGGGCTGGAAGG + Intergenic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915605409 1:156947266-156947288 CAGCAGAAGAGGAGTCTGGAGGG + Intronic
916315310 1:163442283-163442305 CTCCATAAGGAGAGTCAGGAAGG + Intergenic
916636083 1:166670156-166670178 CTGAAGCAGGTGAGTGTGCAGGG + Intergenic
919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG + Intronic
919454817 1:197808722-197808744 GAGAAGCAGAAGAGTCTGGAAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919936514 1:202254365-202254387 CTGGAGTAGGATAGACTGGAGGG + Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921961042 1:221034645-221034667 GTGAATAAGGAGAGTCTAGAGGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
923385850 1:233464659-233464681 CTGAAGAAGGGAAGTGGGGATGG - Intergenic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923515581 1:234695421-234695443 CTGCAGAAGGAATGGCTGGAGGG - Intergenic
923540666 1:234886011-234886033 CTGAAGATGCTGAGTCTGGGTGG - Intergenic
1063310804 10:4949972-4949994 CTAAAGAAAGAGACTCTAGAAGG + Intronic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064772206 10:18735080-18735102 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1065088146 10:22201246-22201268 GTTAAGAAGGAAAGCCTGGACGG - Intergenic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065952734 10:30666759-30666781 CTAAAAAAGGAGGGTGTGGAGGG - Intergenic
1066369649 10:34809627-34809649 CTGCAGAGGGAGTGGCTGGAAGG + Intronic
1066407551 10:35133395-35133417 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067213911 10:44284663-44284685 CTGAAGACTGAGTGTCTGCAAGG + Intergenic
1067283949 10:44894187-44894209 CAGAAGGAGGGGAGTCAGGAGGG + Intergenic
1067894683 10:50166077-50166099 CTGAAGGAGGAGCAACTGGAGGG - Intergenic
1067954158 10:50774185-50774207 CTGAAGGAGGAGCAACTGGAGGG + Intronic
1068092967 10:52455360-52455382 CTGAAGAAGGTGAGTCAGAAAGG - Intergenic
1068802194 10:61154056-61154078 CTCAAGGAGGAGAGTCTGTTTGG + Intergenic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070589638 10:77792674-77792696 CTGGTGAAGGAGAGTCAGGTGGG - Intronic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1074025005 10:109625412-109625434 CTGAAGGAGGGGGATCTGGATGG - Intergenic
1074326925 10:112459532-112459554 CTGAAGAAGCAGAGTCTTTATGG + Intronic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1075953645 10:126504223-126504245 CTGAAGCAGGAGCTCCTGGAGGG - Exonic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1077476816 11:2794350-2794372 CTGAGGTAGGAGGGTCAGGAGGG + Intronic
1077533108 11:3106485-3106507 CTCAGGAAGGGGAGTCCGGAAGG - Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078745970 11:14114603-14114625 GTGAAGAAATAGAGGCTGGATGG - Intronic
1079322544 11:19463663-19463685 CAGAAAAAGCTGAGTCTGGAAGG + Intronic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1083014519 11:59439375-59439397 CTGAAGAGGAAGAGTCTGAGAGG - Intergenic
1083757217 11:64798088-64798110 CTGAGGTAGGAGAATCTGGGAGG - Intronic
1083845250 11:65328099-65328121 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1084634233 11:70380087-70380109 ATTAAGAATGAGAGTTTGGATGG + Intronic
1084870171 11:72093381-72093403 CTGTAGCTGGAGGGTCTGGAAGG - Intronic
1084954099 11:72682313-72682335 CTGGAGGAGGTGAGTCTGAAAGG - Intergenic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1086473503 11:87143760-87143782 TTTAAGAAGGAAATTCTGGAGGG - Intronic
1087008231 11:93489531-93489553 TTGAAGCAGGAAAGTCAGGATGG + Intronic
1087980475 11:104607051-104607073 CTGAAGAATGAACCTCTGGAAGG - Intergenic
1088948556 11:114540541-114540563 AAGAGGAAGGAGAGTATGGATGG + Intronic
1090789004 11:130073740-130073762 CTGAGGCAGGAGAATCTGGGAGG + Intronic
1090831739 11:130425253-130425275 CTGAAGCAGGAGACTCTGCTTGG - Intronic
1091085571 11:132718802-132718824 GTGAAGGAGCAGAGTCTGAAGGG + Intronic
1091112882 11:132987060-132987082 GTGAAGAGGGAGAGCGTGGATGG - Intronic
1091198020 11:133748275-133748297 CTGAAGAAACTGAGTCTGAAAGG + Intergenic
1091240120 11:134046489-134046511 CTTAACAAGGAGAGGCTGGCAGG - Intergenic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092531936 12:9352142-9352164 CTGTAGAAGGAGAGGCTGCCGGG - Intergenic
1094216042 12:27943854-27943876 CTGAAGAAAGAGGGTGTGAATGG + Intergenic
1094807527 12:34107406-34107428 AAGAAGAGGGGGAGTCTGGAAGG + Intergenic
1095349283 12:41189385-41189407 ATGGAAAACGAGAGTCTGGATGG - Intronic
1096084359 12:48855672-48855694 CTGAGGTAGGAGGGTCAGGAGGG + Intergenic
1096570127 12:52518089-52518111 CTGAAGAAGGTGCGTGTGGGTGG - Exonic
1096602810 12:52742351-52742373 CTGAAGCAGCAGGGACTGGAGGG - Intergenic
1096701083 12:53383248-53383270 CTGAAGCTGGAGGTTCTGGAGGG - Exonic
1097110204 12:56652336-56652358 CTGAGGCAGGAGAGTCGGGCAGG + Intergenic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098420716 12:70294209-70294231 GTGAAGAAGGAAAGGTTGGAGGG - Intronic
1098696005 12:73555690-73555712 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1101315085 12:103621631-103621653 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1101661792 12:106773087-106773109 CTCAAGAGGGAGAGACTGGTAGG + Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102373719 12:112404132-112404154 CTGAGGCAGGAGAATTTGGACGG - Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103915784 12:124374914-124374936 GAGAAGCAGGAGAGACTGGAGGG - Intronic
1105541753 13:21321857-21321879 CTGAAGATGGATGGTGTGGATGG + Intergenic
1105635820 13:22214412-22214434 CTAGAGAGGGAGAGGCTGGAGGG - Intergenic
1107232153 13:38123003-38123025 CTGGAGAAAGAGAGCATGGAGGG + Intergenic
1107666924 13:42700159-42700181 CTGAAGAAGTAAAGACAGGAAGG + Intergenic
1108594513 13:51938000-51938022 GTGAAGCAGGAGAGTAGGGAGGG - Intronic
1108699595 13:52932697-52932719 CTGAAGGAGGAAAGATTGGAAGG - Intergenic
1109099123 13:58157312-58157334 CTGATGAAGGAGGGGCTGAAAGG + Intergenic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1109574929 13:64242990-64243012 CTGGTGAAGGAGAGACTGCAGGG + Intergenic
1110558899 13:76888759-76888781 CTGAAGAAGGTGAGAAGGGAGGG - Intergenic
1111949003 13:94694951-94694973 CTGAAGAAAGTGTTTCTGGAAGG + Intergenic
1112498989 13:99927839-99927861 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1112894874 13:104286513-104286535 CACAAAAAGGAGAGTGTGGAGGG - Intergenic
1113279389 13:108772258-108772280 CTGAGGCAGGAGAGCCTGGGAGG + Intronic
1114490087 14:23095081-23095103 CTGGAGGAGGTGACTCTGGACGG - Exonic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1115847237 14:37553305-37553327 GTGAAGAAAGAGGGCCTGGATGG - Intergenic
1116094990 14:40356226-40356248 CTGAAGATGATCAGTCTGGATGG - Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1117330408 14:54706692-54706714 AAGAGGAAGGAGAGTCTGGAGGG + Intronic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1119048023 14:71338106-71338128 ATGAAGAAGGTGGGTCTTGAAGG - Intronic
1119330794 14:73792105-73792127 CTAAGGAGGGAGAATCTGGAAGG - Intergenic
1119383806 14:74244830-74244852 TTGAGGAAGAAGAGTCCGGAGGG + Intronic
1119483728 14:74975222-74975244 CTGAAGAGATAGAGGCTGGAGGG + Intergenic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1120243683 14:81980742-81980764 ATGAAGTAGTATAGTCTGGATGG - Intergenic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1121091733 14:91187661-91187683 GTGATGAGGGAGACTCTGGAGGG - Intronic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122389982 14:101373533-101373555 CTGAAGCACCAGAGTCTGAAAGG - Intergenic
1122598655 14:102909913-102909935 CAAAGGAAGGGGAGTCTGGATGG + Exonic
1124830625 15:33145684-33145706 CTCAAGCAGAAGACTCTGGACGG + Intronic
1125998417 15:44186458-44186480 CTGACTAAGGAGTGCCTGGATGG + Intronic
1126667371 15:51087429-51087451 ATGAGGGAGGAGATTCTGGAAGG - Intronic
1126847073 15:52770163-52770185 CTGCAGTGGGAGAGACTGGAAGG + Intronic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1127957479 15:63865520-63865542 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1127978569 15:64017138-64017160 CTGGAGAAGAAGAGACTTGAAGG - Intronic
1128214134 15:65922679-65922701 CTGCAGAGGGAGAGACTAGAGGG + Intronic
1128525778 15:68411347-68411369 TTGAAGAAGGAGTGTGTGGGAGG - Intronic
1128537198 15:68500399-68500421 GTGAAGGAGGAGAGCCTGGGAGG - Intergenic
1128760639 15:70214084-70214106 CTGGAGAAAGGGAGTCGGGAGGG - Intergenic
1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG + Intergenic
1131242024 15:90753794-90753816 CAGAAGATGGAGAATCTTGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131385942 15:92007501-92007523 CTGAATAGGGATAGTGTGGAAGG + Intronic
1131636039 15:94234182-94234204 ATGAAGGAGGAGAGTATGTAGGG + Intronic
1131873669 15:96783505-96783527 CTGAAGAAGGGGCGTCTAAAAGG + Exonic
1132069231 15:98761164-98761186 CTCCAGTAGGAGAGTCTGCAGGG + Intronic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1132854125 16:2037246-2037268 CTGAGGAGGCAGAGACTGGAGGG - Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133061997 16:3180823-3180845 GTGACGAAGGAGACTCTGGCAGG - Intergenic
1133838566 16:9387920-9387942 CTGAAGTAGGAAAGTCTTGTGGG + Intergenic
1133850870 16:9502158-9502180 CTGAAAAAGGAGAGTCCTAATGG + Intergenic
1137043630 16:35637277-35637299 CTGAAGGAGGAGAGGCTTGTGGG + Intergenic
1137354489 16:47747145-47747167 TTCAAGAAGCAGAGTCTGAAGGG + Intergenic
1138238771 16:55409097-55409119 CAGAATAAGGAGGGTCTTGAGGG + Intronic
1138650414 16:58457380-58457402 ATGATGGAGGAGAGCCTGGATGG + Intergenic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1140149620 16:72348978-72349000 ATGAAGACAGAGAGACTGGAAGG - Intergenic
1141490963 16:84372521-84372543 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1141551306 16:84808490-84808512 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1142194592 16:88733574-88733596 CTGAAGGAGGTGAGTGTGGCAGG - Exonic
1143116139 17:4582795-4582817 CTGAGGCTGGAGAGTGTGGATGG + Intergenic
1143463475 17:7119463-7119485 GTTAAGAAGGGGAGTCTGGGCGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144195888 17:12894717-12894739 CTGTAGCAGGAGAGTCTTCAGGG + Intronic
1144234237 17:13241736-13241758 CTGAAGAAGGCCAGTGTAGATGG + Intergenic
1144304753 17:13958233-13958255 CTGAAGAAGAAGAGACTGTAAGG - Intergenic
1144457115 17:15428110-15428132 CTGAAAAAGACGAGTCTGAAAGG + Intergenic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1145173977 17:20684500-20684522 CTGAGGCAGGAGAATCTGGCAGG - Intergenic
1145285147 17:21500143-21500165 CTGAATACGTGGAGTCTGGAGGG - Intergenic
1145684087 17:26637637-26637659 CTGAGGCAGGAGAGTCAGGCAGG - Intergenic
1147706520 17:42429126-42429148 CTGAGGGAGGAGAATCTGGGAGG - Intergenic
1147985236 17:44302765-44302787 CTGAGGCAAGAGAATCTGGAAGG + Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1148938044 17:51180658-51180680 CTGAAGGAGGAGTTGCTGGATGG - Exonic
1149870287 17:60174917-60174939 CTGAAGGTGGTGAGTCTGCATGG - Intergenic
1150359216 17:64515881-64515903 CTGAAGAAGGAGGGGTTCGAAGG + Intronic
1150499963 17:65641382-65641404 CTGATCAAGGAGAGGCTGCAGGG - Intronic
1150506104 17:65700586-65700608 CTGAAGCAGGAGAGGCTACATGG + Intronic
1151288809 17:73133580-73133602 CTGATGGAGAAGAGGCTGGAGGG - Intergenic
1152453224 17:80396864-80396886 GGGAAGCAGGAGAGACTGGAGGG + Exonic
1153598009 18:6748561-6748583 CTGATGGAGGAGAGGCTGGGAGG + Intronic
1155224718 18:23719196-23719218 CAGAAGAAAGAGAGTCCAGATGG + Intronic
1156022257 18:32613228-32613250 GTGAGGAAGGGCAGTCTGGAAGG - Intergenic
1157647161 18:49286516-49286538 CAGAAGCAGGAGACTCTGGTTGG + Exonic
1157833933 18:50881614-50881636 GTCAAGAATGAGAATCTGGATGG - Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159046519 18:63373986-63374008 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1160573187 18:79832292-79832314 CTGAGGAAGGACAGTGAGGATGG - Intergenic
1161186915 19:2927198-2927220 CTGATGACAGAGATTCTGGAGGG + Intergenic
1161204408 19:3033592-3033614 CAGAAGAAGGAAGATCTGGAGGG - Intronic
1161480578 19:4508363-4508385 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1161506846 19:4648661-4648683 CTGAAGAAGTTGATTCCGGACGG - Intronic
1162300894 19:9844363-9844385 CTGAACAATGAGAGTCTGGCAGG - Intronic
1162759889 19:12882442-12882464 ATGAAAAAGGAGAGTCTGGGTGG - Intergenic
1163292055 19:16385296-16385318 CTGAACCAGGAGACTCAGGAAGG + Intronic
1163538961 19:17895324-17895346 CTGAGGAAGGAGAATCTGGGAGG - Intergenic
1163905253 19:20146720-20146742 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1167669189 19:50839615-50839637 CTGAAGGAGGAGGGGCTGGGGGG + Intergenic
1167689100 19:50974841-50974863 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167689134 19:50974925-50974947 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167689288 19:50975342-50975364 CTGAGGGAGGAGGGGCTGGAGGG + Intergenic
1167890581 19:52536375-52536397 CCGAAGACGGAGAGGCTGGGAGG - Intronic
1168025976 19:53643837-53643859 CTGAGGCAGGAGAATCTGGGAGG + Intergenic
1168649939 19:58086432-58086454 AAGAAGAAGGCGAGGCTGGAAGG + Intronic
926172621 2:10561873-10561895 CTGAGGCAGGAGTGTCAGGAGGG - Intergenic
926358044 2:12059336-12059358 CTTACGGAGGAGAGACTGGATGG + Intergenic
926408435 2:12577614-12577636 ATGAATGAGGAGAGTTTGGAAGG - Intergenic
926966257 2:18415563-18415585 CTGAAGCAGGAGAATCTGGCAGG + Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929435877 2:41927924-41927946 CTTTAGAAGGATAGGCTGGAGGG + Intergenic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930381969 2:50641492-50641514 CTGAAGTAGGAAAGGCTGAAGGG - Intronic
930826194 2:55699404-55699426 CTGAGGAGGGAGAGGCTGCATGG + Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
933665248 2:84959577-84959599 CTGAAGAAGGAGACAGTGTATGG - Intergenic
933936059 2:87204648-87204670 CACAAGAAGGAAAGTCTGAAGGG + Intergenic
934025750 2:88000362-88000384 TGGAAAAAGGAGGGTCTGGAGGG - Intergenic
934947960 2:98555616-98555638 CTGCAGAAGGAGCGGCTGCATGG + Exonic
935233621 2:101119840-101119862 CTGTAGAAGAACTGTCTGGATGG - Intronic
935293793 2:101630895-101630917 CTGAAGCTGGCGAGTGTGGAGGG - Intergenic
935389195 2:102532555-102532577 ATGAGGAGGGTGAGTCTGGAGGG + Exonic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
936514754 2:113174508-113174530 CTGGAGAGAGGGAGTCTGGAAGG + Intronic
937138359 2:119575357-119575379 GTGAGGAAGGAGATTCAGGAGGG - Intronic
937625476 2:124038719-124038741 CAGAAGAAGGGCAGGCTGGATGG - Intronic
937883936 2:126887524-126887546 CTGAGGTAGGAGAATCTGGGAGG - Intergenic
939519761 2:143215177-143215199 CTGAAAATGGAGATTCAGGATGG + Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941263695 2:163331900-163331922 CCTAAGGAGGAGAGTGTGGACGG + Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942724944 2:178996174-178996196 CTGAGGCAGGAGAATCTGGGAGG - Intronic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945940648 2:215946107-215946129 TTGGAGAAGGACAGCCTGGAGGG - Intronic
946412015 2:219520163-219520185 GTGGAGAAGGAGGGTCGGGAGGG - Intronic
946646404 2:221840628-221840650 CTGAAAAAGGAGAGTATTGGTGG - Intergenic
947011501 2:225571376-225571398 CTGAAGAAGCAGAGTCCTCATGG - Intronic
947074377 2:226326247-226326269 GTGAAGAATGAAAGTCTGAATGG + Intergenic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
1170476004 20:16715153-16715175 CAGAAGAATGAGAGACTGGAAGG - Intergenic
1170801731 20:19595998-19596020 GTGAAGAAGGGGAGTATGGCTGG + Intronic
1170981835 20:21221532-21221554 CAAAAGAATGAGAGTCTGAATGG - Intronic
1171467856 20:25343703-25343725 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1173077182 20:39830346-39830368 CTGAAGCAGGACATTCTGAAGGG - Intergenic
1173242404 20:41309266-41309288 CTGAAGAAGGTGGGACTGGTGGG - Intronic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173994861 20:47330123-47330145 CTCACGAAGGTCAGTCTGGAAGG + Intronic
1174173403 20:48630584-48630606 CTGGAGGAGGAGAGACTGCAGGG + Intronic
1175473846 20:59254645-59254667 CTCAAGAAGAGGAGTCTGGAAGG + Exonic
1176388474 21:6151422-6151444 CTGAAGCAGGAGAGACCTGAAGG + Intergenic
1176448783 21:6843916-6843938 CTGAAGAAGGGGAGTCATAAAGG + Intergenic
1176826953 21:13708939-13708961 CTGAAGAAGGGGAGTCATAAAGG + Intergenic
1177511652 21:22094408-22094430 CTGGAGATGGAGAGTTTGCAAGG - Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178340678 21:31783537-31783559 CTGAAGAAGGATAGTTTCGGGGG - Intergenic
1179338940 21:40486322-40486344 CTGAAAAAGGACAGTCAAGAGGG - Intronic
1179734998 21:43386826-43386848 CTGAAGCAGGAGAGACCTGAAGG - Intergenic
1180006310 21:45022577-45022599 CTGAAGAAGGGCAGTCTGGAGGG + Intergenic
1180139986 21:45887419-45887441 CTGATGCTGGAGAGGCTGGAGGG - Intronic
1180240936 21:46504882-46504904 CTGAAGATGGAGAGTGTAGGGGG - Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1182404667 22:30115797-30115819 ATGAAGAAGGAGGGATTGGATGG + Intronic
1182516521 22:30862127-30862149 ATGGAGAAGGAGAGTCTGCGAGG - Intronic
1183717941 22:39545166-39545188 CTGGAGAGGGAGCTTCTGGAAGG - Intergenic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1185039895 22:48498338-48498360 CTGAAGAGGCAGGGGCTGGAGGG + Intronic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950848084 3:16034530-16034552 CTGCTGAAGGAGAATCTGGGTGG - Intergenic
951877357 3:27441983-27442005 CTGAGGCAGGAGAATCTGGGAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
953014180 3:39056942-39056964 GAGAAGAAGGAGGGTTTGGAGGG + Intronic
953878324 3:46678944-46678966 CTGAACTAGGAGGGTATGGAGGG + Intronic
954289436 3:49641989-49642011 CTCAAGCAGGAGGGTCTGGCAGG + Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
954603146 3:51887921-51887943 CTGTTGAAGGGGAGTCTGAATGG + Intergenic
955607670 3:60723082-60723104 CTGAGGAAGAAGAGTCTAGAGGG - Intronic
956376844 3:68622243-68622265 CTGAAGAAGGAGTATGTGAATGG - Intergenic
957625898 3:82651353-82651375 CTGAGGAAGGAGAATCTTTAAGG - Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
960927790 3:122813149-122813171 CTGAAGCAGGAGAATCCGGGAGG + Intronic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961941970 3:130647185-130647207 CTGAAGAAGCCTAGGCTGGATGG - Intronic
962055855 3:131870877-131870899 CTGAAGAAGAGAAGGCTGGAAGG + Intronic
962779228 3:138695852-138695874 CTGAGGCAGGAGAATCTGGGAGG - Intronic
962805985 3:138928270-138928292 CTTAAGAAGGTGTGTGTGGAAGG + Intergenic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
963438255 3:145300307-145300329 CAGAAAAAGGAGAGTCCGGGCGG - Intergenic
964554000 3:157915640-157915662 CTGGTGAAGGAGAGCCTTGAGGG - Intergenic
965397831 3:168181833-168181855 GTGAAGAAGGGAAGTTTGGAAGG + Intergenic
965593598 3:170385889-170385911 CTGAGGCAGGAGAATCTGGGAGG - Intronic
966012421 3:175097196-175097218 CTGAAGATGGAGCATCTGAAGGG - Exonic
967442788 3:189528285-189528307 CTGAGGCAGGAGAACCTGGAAGG - Intergenic
967546153 3:190731262-190731284 CTGAAGGAGGTGAGGCTGTAGGG + Intergenic
967792867 3:193567853-193567875 CAGAAGAAGGGGAGTCTGTTTGG - Intronic
967874988 3:194262350-194262372 CAGAAGACGGAAATTCTGGAAGG + Intergenic
968376717 4:50078-50100 CTGCAGGAGGAGAGCCTGCAGGG - Intergenic
970511338 4:16784748-16784770 CGGAAGAAGGAGAGAGTGGTGGG - Intronic
971055307 4:22906581-22906603 CTGAAGAAGGAACAACTGGAAGG - Intergenic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
972602599 4:40586342-40586364 CCAGAGAAAGAGAGTCTGGAAGG + Intronic
973263221 4:48185954-48185976 CTGAGGCAGGAGAATCTGGCAGG - Intronic
975165066 4:71169106-71169128 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
975571459 4:75822250-75822272 CTGAAGAAGCAGCTTCTGGCTGG + Intergenic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976278344 4:83301404-83301426 CTGAAAATGGATAGTCTGGCTGG - Intronic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
978937417 4:114395010-114395032 CTGGAGAAGCTGTGTCTGGATGG - Intergenic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
980848548 4:138353573-138353595 CTGAAGCAGGAGAATCCTGAAGG + Intergenic
980956143 4:139431005-139431027 CTGAAGACCATGAGTCTGGATGG + Intergenic
980993745 4:139761368-139761390 GTGATCAAAGAGAGTCTGGAGGG + Intronic
981135543 4:141207013-141207035 CAGAAGAAGGTGAGACTGGCTGG - Intronic
981318315 4:143363526-143363548 TTGAAGAAGGAAAGTGTGGTTGG + Intronic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
981743413 4:148028106-148028128 CTGAGGAAGGGAAGTCTGTAGGG + Intronic
982964046 4:161879564-161879586 GTGAGGAAGGAGAGACTGAATGG - Intronic
985047243 4:185952592-185952614 TTGAATAGGGAGAGTCTGGAGGG + Intronic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985632310 5:1020466-1020488 CTGACGATGGAGACTCTGGGAGG + Intronic
986995560 5:13603253-13603275 CTGAAGAAAGATAGTGTGGCTGG - Intergenic
988297287 5:29382064-29382086 CAAAAGAAGGAGAATATGGATGG - Intergenic
988969419 5:36451292-36451314 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
988977443 5:36529011-36529033 CTGAAAATGGAGAGACTGGGTGG - Intergenic
989354109 5:40522040-40522062 CTTAAGAAGGAGTGGCAGGAAGG + Intergenic
989543006 5:42639940-42639962 TTGAAGAAGGGAAGTGTGGAGGG + Intronic
992674786 5:79095279-79095301 CTGAAGTTGAAGAGACTGGAAGG + Intronic
992807485 5:80351817-80351839 CGGAACAAGGAGACGCTGGAGGG - Intergenic
993682749 5:90899756-90899778 ATGGAGCATGAGAGTCTGGAAGG - Intronic
995816641 5:116176899-116176921 CTGAAGGAGGAGAGTATTTAAGG + Intronic
995849996 5:116534858-116534880 CTGCAGAAGGACTGTCTAGAAGG + Intronic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
997606141 5:135176993-135177015 CTGAAGAAGCAGGGAATGGAGGG + Intronic
999236825 5:150103629-150103651 CAGAAGATGGAGAGTCTGTGAGG + Intronic
999749828 5:154619443-154619465 ATGAAGAAGGAGGGTCGGGGAGG + Intergenic
1000483720 5:161812352-161812374 CTGAAGAATCAGAGTCTGAAGGG + Intergenic
1000574456 5:162959704-162959726 CTGAGGAAAGCGGGTCTGGAAGG + Intergenic
1000866024 5:166515797-166515819 CTGAAGATGAAAAGTGTGGAAGG + Intergenic
1001001057 5:168007423-168007445 TTGAAGAAGGAAAGCCTGGCTGG - Intronic
1001848347 5:174941142-174941164 CTGAAGAAGGAGAGTCCCAACGG - Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1003410403 6:5856936-5856958 CTGAAGATGGATGGTGTGGATGG - Intergenic
1003879996 6:10471244-10471266 CTGCAGAAAGAGAGGCTGCAGGG + Intergenic
1004205604 6:13589225-13589247 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1004589719 6:17037837-17037859 ACGAAAAAGGAGAATCTGGATGG - Intergenic
1005626788 6:27669919-27669941 CAGAAGAAGATGAGTGTGGAAGG - Intergenic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006149194 6:31976943-31976965 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
1006589774 6:35146010-35146032 CTGAAGGATGAGAGTCAGGGAGG - Intronic
1007041200 6:38724074-38724096 CTGAGGCAGGAGAATCCGGAAGG - Intronic
1007611309 6:43151115-43151137 ATGAAAAAGCAGAGTCTGGCTGG - Intronic
1007986355 6:46211071-46211093 CTGAAGAAGTGGAGCATGGAAGG - Intergenic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008806067 6:55430095-55430117 CTGGAGAAGGAAAGTTTAGATGG + Intergenic
1011164634 6:84432007-84432029 CAGAAGAAGAAGAGACTGGGAGG - Intergenic
1011350205 6:86414714-86414736 CTGTAGAAGGAGACTGTGGCAGG + Intergenic
1012553742 6:100488108-100488130 CTCAAGAAAGTGAGTTTGGAGGG - Intergenic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013185868 6:107757423-107757445 CTGAGGATGGAGAGTGTGGCTGG + Intronic
1013521509 6:110937954-110937976 ATGAACAAGAAGAGACTGGAAGG + Intergenic
1013521656 6:110939045-110939067 CTGAAGTAAGAGAATCTGGGAGG - Intergenic
1016223054 6:141699318-141699340 CTGAAGGAGGAGAGTGGGAAGGG + Intergenic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1017507870 6:155085020-155085042 CTGTAAATGGAGACTCTGGAGGG + Intronic
1017928984 6:158936296-158936318 CTTAAGAATGATAGTCTGGCCGG - Intergenic
1018399522 6:163408774-163408796 CTGAAGAAGCAGAGGCTGAGAGG - Intergenic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1020066787 7:5194373-5194395 ATGAAGAAGGAGAGTCTTTACGG + Intronic
1020452654 7:8337509-8337531 CTGCTGCAGGAGAGACTGGAAGG - Intergenic
1021180476 7:17499879-17499901 CAGAAGATGAAGAGTTTGGAGGG + Intergenic
1022317935 7:29263125-29263147 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1022461155 7:30608525-30608547 CTGTAGAAATAGAGTCTAGAAGG + Intronic
1022547577 7:31203120-31203142 CTGATGAAGGTGAGTCTGAGAGG + Intergenic
1022870367 7:34471774-34471796 CTGAGGGAGGAGAATCTGGCTGG + Intergenic
1023176359 7:37439288-37439310 GTGATGGAGGACAGTCTGGAAGG - Intronic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1024343508 7:48290372-48290394 CCGGAGAAGGAGAGTCTGATAGG + Intronic
1024770071 7:52712353-52712375 ATTAAGAAGGAGAGGATGGAGGG + Intergenic
1025094197 7:56084954-56084976 CTGCAGCTGGTGAGTCTGGAGGG + Intronic
1025602846 7:63015878-63015900 TTTCAGAATGAGAGTCTGGAGGG - Intergenic
1025821789 7:64968969-64968991 CTGAGGCAGGAGAGTCAGGCAGG + Intergenic
1026638945 7:72107537-72107559 CTGGAGAAGGGGACTCTGGGTGG - Intronic
1028633959 7:92966490-92966512 CTGAAGTAGGGTAGTCAGGAGGG + Intergenic
1029117258 7:98243671-98243693 CTGAAGAATGGAAGTCCGGATGG - Intronic
1029821511 7:103151543-103151565 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031050659 7:116941684-116941706 CTGAAGCAGAAGAATCTGGGAGG + Intergenic
1031368313 7:120931514-120931536 CTGAAGAAGTAAATTATGGATGG - Intergenic
1031675735 7:124610023-124610045 CTGAAGAGGGAGGGTGTCGAGGG + Intergenic
1033375363 7:140756359-140756381 CTGTAGAATGAAAGGCTGGAAGG + Intronic
1034171045 7:149063416-149063438 CAGGAGTAGGAGAATCTGGATGG - Intergenic
1034254641 7:149717895-149717917 CTGAGGCAGGAGAACCTGGAAGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034534900 7:151720644-151720666 ATGAAGGAGGAGAGAATGGAGGG + Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1036490990 8:9225322-9225344 GTGAAGGTGGAGATTCTGGAAGG + Intergenic
1037075866 8:14717474-14717496 TTGAAGAAGAACAGTCTGGAAGG + Intronic
1037616714 8:20525907-20525929 CAGAAGTAGGAGAGTCTGGTGGG - Intergenic
1037785067 8:21897886-21897908 CTGAAGGAGGTGAGCCTGGCTGG + Intergenic
1037853161 8:22349514-22349536 CTGAAGAAATTGAGTCTTGAAGG + Intronic
1038160403 8:25031642-25031664 CTGTAGATGGGGAGTCTGCACGG - Intergenic
1038272809 8:26089675-26089697 CTGAAGACGTAGATTCAGGAAGG - Intergenic
1038657694 8:29469128-29469150 CTGAAGCAGGAAGGTTTGGATGG + Intergenic
1038677910 8:29640211-29640233 CTGAAGAAGGAGGATAGGGAAGG + Intergenic
1041146638 8:54883176-54883198 CTGTGGCAGGAGAGTCTTGAGGG - Intergenic
1041312844 8:56534005-56534027 TTGAAGAATGAGGGTCTGTAAGG + Intergenic
1041886708 8:62817431-62817453 CAGAAGAAGGTGAATCTGGGAGG - Intronic
1042166301 8:65949110-65949132 AGGAAGGAGGAGAGTCTGAAGGG - Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042598731 8:70476953-70476975 CTAAAGAAGGAGAACCTGTATGG + Intergenic
1042710854 8:71715603-71715625 CAGAAGGAGTAGAGACTGGAAGG - Intergenic
1042802228 8:72732025-72732047 CTGAAGGAGGAGATTCAGCAGGG - Intronic
1044031479 8:87242936-87242958 CTGAAAAAGGACAGGGTGGAGGG + Intronic
1044523489 8:93225720-93225742 CTAAAGAAGGAGAATCCGCAAGG - Intergenic
1044860539 8:96519037-96519059 CTGTAGTGGGAGTGTCTGGATGG - Intronic
1047301137 8:123614254-123614276 CAGAAGAAGGAAAGCCTGGAAGG + Intergenic
1047512980 8:125529564-125529586 GGGAAGAAGGAGACTCTGGTGGG + Intergenic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048767005 8:137855630-137855652 CTCAGGATGGAGAGTCTGGAGGG - Intergenic
1048994041 8:139778817-139778839 CTGAAGGAGAAGAGAGTGGAGGG + Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049125699 8:140785607-140785629 ATGAAGATGGAGAGTCTTCATGG - Intronic
1049702426 8:144021243-144021265 CTGAAGGAAGAGAGTCCTGAGGG - Intronic
1049702457 8:144021358-144021380 CTGAAGGAAGAGAGTCCTGAGGG - Intronic
1049702559 8:144021771-144021793 CTGAAGTGGGAGGGTCTTGAGGG - Intronic
1049702613 8:144021997-144022019 CTGAAGTGGGAGGGTCTTGAGGG - Intronic
1049702659 8:144022173-144022195 CTGAAGTGGGAGGGTCTTGAGGG - Intronic
1049702765 8:144022618-144022640 CTGAAGTGGGAGGGTCTTGAGGG - Intronic
1049703065 8:144023738-144023760 CTGAAGGAAGAGAGTTTTGAGGG - Intronic
1049703299 8:144024548-144024570 CTGAAGGAAGAGAGTTTTGAGGG - Intronic
1050023220 9:1306690-1306712 ATGAAGAAGGAGGGTCTGCAGGG + Intergenic
1051848468 9:21479740-21479762 CTGAAGAAGGAGATTAGGGTGGG - Intergenic
1053053613 9:34980590-34980612 CTGCAAAGGGAGATTCTGGACGG - Exonic
1053375987 9:37606834-37606856 CTGGAGTAGGAGTGTCTGCAGGG + Intronic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055332861 9:75202131-75202153 CTACAGAATCAGAGTCTGGAGGG + Intergenic
1055749667 9:79490998-79491020 CTGAGTAATGAGTGTCTGGAAGG - Intergenic
1056336289 9:85573200-85573222 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1057838770 9:98468168-98468190 CTGAAGAACGTGCTTCTGGAGGG + Intronic
1057986028 9:99715087-99715109 CTGAAGCAGGAGAACCTGGGAGG - Intergenic
1058228741 9:102399218-102399240 CTGAAGAGGGGGAGTGGGGAAGG + Intergenic
1058402563 9:104635068-104635090 CTGAAGACGGATATGCTGGATGG - Intergenic
1059051869 9:110935179-110935201 ATGAAGATGGAAAGTGTGGATGG + Intronic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1059358373 9:113718912-113718934 CTGGAGAAGGAGGCTCTTGATGG + Intergenic
1060188094 9:121576028-121576050 CTGGAGACGGAGAGTCGGGGTGG - Intronic
1061654667 9:132079705-132079727 CGGAACAAGGAGACGCTGGAGGG - Exonic
1061774148 9:132949413-132949435 CTCAAGAAGGAGAATCAGGCTGG - Intronic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1203520406 Un_GL000213v1:40601-40623 CTGAAGAAGGGGAGTCATAAAGG - Intergenic
1203572513 Un_KI270744v1:144168-144190 CTGCAGGAGGAGAGCCTGCAGGG + Intergenic
1186881348 X:13869622-13869644 CTGAACAAGGGCATTCTGGAAGG - Intronic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1188111905 X:26204405-26204427 CTGCGTAAGGAGACTCTGGAAGG + Intergenic
1190142523 X:47860662-47860684 CTGAAGTAGGACAGTCTTGTGGG + Intronic
1190261264 X:48798948-48798970 CTGAGGCAGGAGAATCTGGGAGG - Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1193283593 X:79685685-79685707 CTGAATAAGGACAGTCTCAATGG - Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1193981186 X:88184025-88184047 CTGAAGAAGAAAAAGCTGGAAGG - Intergenic
1195111610 X:101656554-101656576 CTGAGGAAGGGGAGTCCGGGTGG - Exonic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195322224 X:103729188-103729210 CTGGGGAAGGAGTGTCTGGGAGG - Intergenic
1195443946 X:104929243-104929265 CTGAATAAGGAGTTTCTTGATGG - Intronic
1196318588 X:114260742-114260764 CAGAAGATGGAGAGAGTGGATGG - Intergenic
1197927288 X:131660095-131660117 CTGAAAAAGGAGACCCTGTATGG + Intergenic
1200207078 X:154324234-154324256 CTGAGGCAGGAGAATCTGGGAGG - Intronic
1200827166 Y:7657652-7657674 TGGAGGAAGGAGAGTCTGCAAGG + Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic