ID: 1178282365

View in Genome Browser
Species Human (GRCh38)
Location 21:31294398-31294420
Sequence GTGGAGAAGCAGAGTTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178282365_1178282371 7 Left 1178282365 21:31294398-31294420 CCTTTCTAACTCTGCTTCTCCAC 0: 1
1: 0
2: 2
3: 39
4: 339
Right 1178282371 21:31294428-31294450 CAGGGAGTTTGAATTTTCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 280
1178282365_1178282370 6 Left 1178282365 21:31294398-31294420 CCTTTCTAACTCTGCTTCTCCAC 0: 1
1: 0
2: 2
3: 39
4: 339
Right 1178282370 21:31294427-31294449 GCAGGGAGTTTGAATTTTCAAGG 0: 1
1: 0
2: 1
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178282365 Original CRISPR GTGGAGAAGCAGAGTTAGAA AGG (reversed) Intronic
900123030 1:1057348-1057370 GGGGAGAAGCAGGGGAAGAAGGG + Intergenic
901279223 1:8019654-8019676 GGGGAGAAGCAGATTTATAAAGG + Intronic
903456702 1:23492428-23492450 GAGGAGAGGGAGAGTGAGAAGGG - Intergenic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
905015377 1:34774622-34774644 GTGGCGATGCTGAGCTAGAAGGG + Intronic
906006291 1:42474730-42474752 GTGAAGAAGCAGGCTTAGAGAGG - Intronic
906654949 1:47541400-47541422 GTGTCCAAGTAGAGTTAGAAGGG + Intergenic
906711364 1:47932434-47932456 GTGGAGGAGCTGAGTTATAATGG + Intronic
907611715 1:55877761-55877783 GTGGAGAGGCAGAGTCAAAAAGG + Intergenic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
909483346 1:76148779-76148801 GTGGAAAAGCTGTATTAGAAAGG - Intronic
909803207 1:79840771-79840793 CTGGAGAAGAGGTGTTAGAAAGG - Intergenic
911544323 1:99198467-99198489 GTAGATAAGCAGAGGTAAAATGG + Intergenic
912022286 1:105120297-105120319 GGGGTGAAGCAGAGTTAGTAGGG - Intergenic
912624313 1:111194951-111194973 GTGGTGAAGCACAGTGAGAGAGG - Intronic
912981629 1:114379286-114379308 GTGGAGAACCAGATTAAAAAAGG - Intergenic
913130307 1:115833129-115833151 GTCTAGAAGCAGCGTGAGAATGG + Intergenic
915836866 1:159183797-159183819 GGGGACAGACAGAGTTAGAAAGG + Intronic
915938643 1:160104228-160104250 GTGGACAAGCAGAGGAAGCAGGG - Intergenic
916404453 1:164484099-164484121 TTGGAGAAGCATATTTAAAAAGG - Intergenic
918014441 1:180619387-180619409 AGGGAGAACCTGAGTTAGAATGG + Intergenic
918217455 1:182404865-182404887 GTGGAGGATCAAAGTTAGCACGG - Intergenic
919751723 1:201041875-201041897 ATGGAGAAGCAGGGTTCCAAAGG - Intronic
920452330 1:206068942-206068964 GGGTAGAAGCAGAGTTAGTTTGG - Intronic
922689004 1:227672317-227672339 GTGGGTATGGAGAGTTAGAAAGG + Intronic
923062580 1:230489426-230489448 GTGGAGCAGGAGAGAGAGAACGG - Intergenic
923341039 1:233007381-233007403 GTGGAGAAAGAGAGTAAGATGGG + Intronic
923827405 1:237515740-237515762 GAGGAGAAGAAGAGGAAGAAGGG - Intronic
1063293971 10:4782735-4782757 GTGGAGAAGCAGTCTAGGAATGG - Intergenic
1063525700 10:6782825-6782847 GCAGAGACTCAGAGTTAGAATGG - Intergenic
1067169045 10:43890827-43890849 GAGGAGAAGGAGAAATAGAAAGG - Intergenic
1067184166 10:44013046-44013068 GAGGAGAAGCAGAGGAGGAAAGG - Intergenic
1067238762 10:44472975-44472997 GGGGAGAAGGACAGTAAGAATGG - Intergenic
1067245383 10:44537070-44537092 GTGGCCCAGCAGAGTTAGATTGG - Intergenic
1067349391 10:45462329-45462351 GGGGGGAAACAGAGTTAGGATGG + Intronic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1069225953 10:65944371-65944393 GTGGAGAAGCAGATGTATAATGG + Intronic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071176559 10:82932924-82932946 TTGGAAAAGGAGAGTTAGAAAGG - Intronic
1072700582 10:97638345-97638367 GAGGGGAAGCAGAGTTAAACTGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074723367 10:116283241-116283263 TTCTAGAAGCAGAGATAGAAAGG + Intergenic
1075662703 10:124209306-124209328 GTGGAGGAGCAGAGTTACAGAGG + Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1076617218 10:131763329-131763351 GTGGAGAAGCAGGCTTGGTAGGG + Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080808739 11:35681561-35681583 GTGGAGAAGTACAGATAGCAGGG + Intronic
1081545874 11:44071220-44071242 GTACAGAGGCAGAGTTAGCATGG - Intronic
1081593666 11:44444521-44444543 GTGGAGAGGCAGAGGTGGAATGG + Intergenic
1081700286 11:45148129-45148151 GTGGACAAGCAGAGTTCTATAGG + Intronic
1083367544 11:62150568-62150590 GGGCAGAGGCAGAGCTAGAATGG + Intronic
1085837463 11:79972236-79972258 GTGCAGAAGGAGAGAGAGAATGG - Intergenic
1088220718 11:107567319-107567341 GTGCAGAAGCAGAATTGCAATGG - Intergenic
1088321990 11:108563752-108563774 GTGGAGAGGCAGAGGTTGATGGG + Intronic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1088741425 11:112770471-112770493 GAGGATAAGGAGAGGTAGAAGGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090432692 11:126659667-126659689 GATCAGAAGCAGAGTCAGAATGG + Intronic
1090552934 11:127842514-127842536 CTGGACAAGCAGAGTTAGGGTGG - Intergenic
1090763927 11:129860672-129860694 GTGACGTAGCAGGGTTAGAATGG - Intergenic
1091040836 11:132279715-132279737 GTGGAGAAGGTGAGTTATTAGGG - Intronic
1091085571 11:132718802-132718824 GTGAAGGAGCAGAGTCTGAAGGG + Intronic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1094138188 12:27151595-27151617 ATGGTGAAGCAGAGTTAATAGGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG + Intronic
1098312887 12:69165111-69165133 GTTGTAAATCAGAGTTAGAAGGG - Intergenic
1098961307 12:76742369-76742391 GTGGCAAATCAGAGTTAGGAGGG + Intergenic
1099869592 12:88330008-88330030 GTGGAGCTGCAGACTTGGAAAGG + Intergenic
1101254045 12:102959869-102959891 GAGGAGAAGCAGAGTTTCAAAGG - Exonic
1101993980 12:109511598-109511620 GTTGAAAGGCTGAGTTAGAAAGG + Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106606524 13:31234342-31234364 GTGGAAGAGCAGTGATAGAAGGG + Intronic
1107632234 13:42354365-42354387 GTTCAGAAGCACAGATAGAAAGG - Intergenic
1107658237 13:42613619-42613641 GTGGAAAGGCAGAGTTTGACTGG + Intergenic
1107887741 13:44888360-44888382 ATGGAAAAGTAGATTTAGAAAGG + Intergenic
1108246558 13:48520691-48520713 CTGGAGAAGCATAGTTATACAGG - Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108556293 13:51596104-51596126 GGGGAGAAGGAGTGTTGGAATGG + Intronic
1109185731 13:59265405-59265427 GTAGAGAAGCAGAGTTACAGAGG + Intergenic
1110050847 13:70897084-70897106 GTCGAGAAGCAGAGATGGCAAGG + Intergenic
1110399791 13:75076585-75076607 CTGAGGAAGCAGAGCTAGAAGGG + Intergenic
1113955259 13:114096974-114096996 GTGGAGGAGCAGACTCAGAGTGG - Intronic
1114604881 14:23988617-23988639 GTGGACAAGCAGATGCAGAAGGG + Intronic
1115224011 14:31085120-31085142 CTGGCGAAGCAGACATAGAATGG - Exonic
1115733516 14:36297699-36297721 GTGGGGAAGCAGAGATAAAAAGG + Intergenic
1116055531 14:39859679-39859701 GTGGAGAGGCTGTGTGAGAATGG + Intergenic
1116949713 14:50868055-50868077 GAAGAGAAGCAGAGCTAGGAAGG + Intronic
1117092388 14:52264263-52264285 ATTTAGAAGCATAGTTAGAATGG + Intergenic
1117232370 14:53733915-53733937 TCAAAGAAGCAGAGTTAGAATGG + Intergenic
1117334206 14:54743009-54743031 CTGGAGAAGCAGAGGTTCAAAGG - Intronic
1117335745 14:54755756-54755778 GTGGAAAAGGAAAATTAGAATGG + Intronic
1117725223 14:58666504-58666526 CTGGTGAAGCAGTGTTTGAAGGG + Intergenic
1118348785 14:64958957-64958979 GTGGAGAAGCAGGTTCAGACTGG + Intronic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121248524 14:92482650-92482672 GTGAAGGGGCAGAGTGAGAAAGG - Intronic
1121708218 14:96017158-96017180 GAGGAGGAGCAGAGTGGGAAAGG - Intergenic
1122519300 14:102332199-102332221 GTGGAGAAGCACAGTGAGCCGGG - Intronic
1123815187 15:23971085-23971107 GTGGAGATGCAGAGAGTGAAAGG + Intergenic
1124039240 15:26084719-26084741 GTGGACTAGCAGAGTGGGAAAGG - Intergenic
1124196204 15:27632052-27632074 GTGAAAAAGCTGAGATAGAAAGG - Intergenic
1126885336 15:53142803-53142825 GAGCAGAAGCAGTGTAAGAAGGG - Intergenic
1126961148 15:53995878-53995900 GTGGAGAAGTAGAGAGAGAGAGG + Intergenic
1127488530 15:59440757-59440779 GTGGAGAAACAGAGTCACAGAGG - Intronic
1127948714 15:63783111-63783133 ATGCAGTAGCAGAGTTAGAGAGG + Intronic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1129827238 15:78641747-78641769 GGGAAGGAGCAGAGTTAAAAGGG + Intronic
1130912110 15:88277804-88277826 GAGGGGAAGAAGAGATAGAAAGG - Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132508075 16:322468-322490 GTGCAGGAGCTGAGTTAGCATGG + Intronic
1133801819 16:9091292-9091314 GTGGAGGGGAAGAGCTAGAAGGG - Intergenic
1134034639 16:11020444-11020466 CTGGAGAAGCAGGGAAAGAAAGG - Intronic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1135996828 16:27256396-27256418 GAGGAGAAGCAGAGTGGGAGTGG - Intronic
1139197092 16:64932203-64932225 GTGCAGAAACAAAGTTAGAAAGG - Intergenic
1139230795 16:65280620-65280642 GAGGAAAATCAGAGTTAGGAAGG + Intergenic
1139231067 16:65283044-65283066 GAGGAAAATCAGAGTTAGTAAGG - Intergenic
1139303582 16:65964773-65964795 GTGGAGAACCAGATTTTGTAAGG + Intergenic
1141555334 16:84833531-84833553 GTAGAAGAGCAGAGTTAGAGTGG + Intronic
1143328671 17:6118490-6118512 GGGCAGAAGCAGAGATGGAAAGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146912209 17:36656163-36656185 GAGGGGAACCAGAGTTGGAAAGG - Intergenic
1146936824 17:36817274-36817296 GAGGAGAGGCTGAGCTAGAAGGG + Intergenic
1146938268 17:36826006-36826028 GCGGTGAAGCAGAGCTAGCAGGG - Intergenic
1146948841 17:36891997-36892019 GTGGAGAAGCAGAGTGAAAGAGG + Intergenic
1148335519 17:46838290-46838312 GTGGATCAGAAGAGATAGAACGG + Intronic
1148432665 17:47654918-47654940 GAGGACTAGCAGAGCTAGAATGG - Intronic
1148943604 17:51238102-51238124 GTGGAAAAGGGGAGTTATAAAGG + Intronic
1149549664 17:57530992-57531014 GTGGAGAAGCAGGGAGAGAAAGG + Intronic
1149634178 17:58153276-58153298 GTGGTAAAACAGGGTTAGAATGG - Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150842357 17:68620646-68620668 GTGGAGAAAAAGAGATAGAAAGG + Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151185880 17:72363607-72363629 GTGGGGAAGCTGAGCTAGGAAGG - Intergenic
1153432165 18:5029577-5029599 GTGGAGATGCAGATTTAAACAGG - Intergenic
1154005390 18:10523266-10523288 GGGGAGAAGAAGAGAGAGAATGG - Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155503151 18:26506685-26506707 CTGGAGAAGAGGAGGTAGAAAGG + Intronic
1155561855 18:27087387-27087409 GCGAAGAAGCTCAGTTAGAAAGG - Intronic
1156700428 18:39818381-39818403 GTTGAGAAGCAGATTTTGGAGGG + Intergenic
1158343432 18:56490420-56490442 GTGGAGAATGAAAGTTAGGAAGG + Intergenic
1158410732 18:57203638-57203660 GTCTAGAAGCAGAGTTTCAAAGG - Intergenic
1160271644 18:77391656-77391678 GGGGGGAAGCAGAGCTATAAAGG - Intergenic
1162784343 19:13024919-13024941 GGAGAAAAGCAGCGTTAGAAGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1164035592 19:21451332-21451354 GTGGGAAAGCAGAGTTACCAGGG - Intronic
1164747252 19:30625573-30625595 GTGAAGAAGCAGTGTCAGATAGG + Intronic
1165063182 19:33214879-33214901 GTGGGGAGGCAGTGATAGAAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166998621 19:46731940-46731962 GTGGAGAAGCAGAGCTCGTCTGG - Intronic
1167406134 19:49309982-49310004 ATGGAGAAGTAGAAGTAGAAGGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167766337 19:51485196-51485218 GAGGGGAAGCAGAGCCAGAAGGG + Intronic
1168507566 19:56949506-56949528 GTGCAGAAAAATAGTTAGAAAGG - Intergenic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926043052 2:9690235-9690257 GTGGGGAGGCAGTGTGAGAAGGG + Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG + Exonic
927407131 2:22783647-22783669 GTGAAGAAGCAGAATTTGAATGG - Intergenic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
927721518 2:25386099-25386121 GTTGAGAAACAGTGCTAGAATGG + Intronic
927927744 2:27025252-27025274 TTGGGGAAGTAGAGTTGGAAGGG - Intronic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
929151084 2:38750136-38750158 CTGGCAAAGGAGAGTTAGAAAGG - Exonic
931653758 2:64491394-64491416 TGGGAAAAGCAGAATTAGAAAGG + Intergenic
931883509 2:66591112-66591134 GAGGTGAAGGAGAGTAAGAAAGG - Intergenic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
936544572 2:113379942-113379964 AGGGAGAAGCACAGATAGAAAGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
938804378 2:134792480-134792502 GTGCAGAAGAAAGGTTAGAAGGG - Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
940069528 2:149670065-149670087 GTAAAGAAGCAGAGTAAAAATGG + Intergenic
940357887 2:152765565-152765587 GTGGGGCAGCAGAGATAGAAAGG + Intergenic
941789079 2:169531206-169531228 GAGGAAAAGCAAAGTTACAAAGG + Intronic
944496672 2:200314093-200314115 CTGGAGATGCAGATTTACAATGG - Intronic
945407688 2:209469594-209469616 GTGCAGAGGGAGAGTAAGAAAGG - Intronic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946179712 2:217942152-217942174 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946199599 2:218064195-218064217 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946535119 2:220619386-220619408 GTGTAGAAGCTGATGTAGAAAGG + Intergenic
946755215 2:222938072-222938094 AGGGAGGAGCAGAGTTACAAAGG - Intronic
947314096 2:228836275-228836297 GTGGCAAAGCAAAGTTATAAAGG - Intergenic
947773311 2:232687969-232687991 GTGGACAGGCAGAGTCAGCAAGG - Intergenic
947907231 2:233774243-233774265 GAGGAGTGGCAGAGTGAGAAGGG + Intergenic
948322520 2:237082062-237082084 ATGGAGAAGAAGACTTTGAAAGG + Intergenic
1169553742 20:6727934-6727956 GTAGAGCAGCAGAGGTAGAAAGG + Intergenic
1170404008 20:16017569-16017591 GTGGAGAAGGAGGGAGAGAAAGG - Intronic
1170828748 20:19821111-19821133 GTGGAGAAACAGAGTTAAAGCGG - Intergenic
1171565223 20:26178088-26178110 GAGGAGAATCAGAGAAAGAAAGG + Intergenic
1175568512 20:60000236-60000258 GTGTGGAAACAGAATTAGAAAGG + Intronic
1176122019 20:63458257-63458279 GTGGAGAAGCTGGGTGGGAATGG + Intronic
1176366793 21:6038075-6038097 GTGCAGGAGCAGAGATGGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177389869 21:20454124-20454146 GTGGTGAAGTATAATTAGAAAGG + Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178701818 21:34840365-34840387 GTAGAAAAGCAGATTTAGAATGG - Intronic
1178829356 21:36042346-36042368 TTGGAGAAGCAGGGTAATAAGGG + Intronic
1179756725 21:43500469-43500491 GTGCAGGAGCAGAGATGGAAGGG + Intergenic
1180080509 21:45485671-45485693 GTGGAGACCCAGACCTAGAAGGG + Intronic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1182681254 22:32081834-32081856 GAGGAGAGGCGGAGTTAGGAGGG - Intronic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183040455 22:35173950-35173972 GTGGAAATGCAGAGACAGAAAGG - Intergenic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1183551005 22:38485303-38485325 GTGGGGAGGCAGAGTGTGAAGGG + Exonic
1184330486 22:43824092-43824114 GTGGGGAAGCACAGTTGGAGGGG + Intergenic
1185092790 22:48785336-48785358 GTTGGGGAGCAGAGTGAGAAGGG - Intronic
950565744 3:13768587-13768609 GAGGAGCAGCAGAGATAGCAGGG - Intergenic
950571833 3:13805545-13805567 GTGGAGAACAAGAGACAGAAAGG - Intergenic
950644559 3:14369388-14369410 GTGGGGAAGCGGGGCTAGAAGGG - Intergenic
951025208 3:17821094-17821116 GCAGAGAAGCAAAGTGAGAAAGG - Intronic
951768060 3:26222549-26222571 GTGGACAACCAGACTTAAAATGG - Intergenic
954582164 3:51708764-51708786 GTGGGGAGGCAGAGTCAGAAGGG + Intronic
954596677 3:51830909-51830931 GTAGAGAAGCAGAGAAAGAGTGG - Intergenic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
955997934 3:64696724-64696746 GTGGAGGAGATGATTTAGAATGG + Intergenic
958802843 3:98776563-98776585 GAGGAGGAGCTGAGGTAGAAGGG + Intronic
959546739 3:107605240-107605262 GGGGACCAGCAGAGTTAGATTGG - Intronic
959560708 3:107777330-107777352 GTTGAGAAGCAGAGATAAGAGGG - Intronic
960041485 3:113154135-113154157 GTAGAGCAGCAGGGTCAGAAAGG - Intergenic
960573963 3:119211292-119211314 GTGGGGAAGGAGAATTTGAAAGG - Intergenic
962499396 3:135974666-135974688 GCTGAGAAGCAGAGTTTGAAAGG - Intronic
962739651 3:138353873-138353895 TGAGAGAAGCAGAGTCAGAAAGG + Intronic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
963670195 3:148241828-148241850 GTGGTGAAGAAGAGAAAGAAGGG + Intergenic
965129200 3:164673163-164673185 GTGGAGAAACATAGTCAAAAAGG - Intergenic
967263547 3:187669963-187669985 GGGGAAAAAAAGAGTTAGAAGGG + Intronic
967426332 3:189331618-189331640 TTGGATAAGCTGAGTTTGAAAGG + Intergenic
968982321 4:3856946-3856968 GAGGTGCAGCAGAGGTAGAAGGG + Intergenic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
970715642 4:18919265-18919287 GTGCATAAGCTGAGTTAGGATGG + Intergenic
970808063 4:20059446-20059468 ATGGGGAAGCAGACATAGAAAGG + Intergenic
971244730 4:24917469-24917491 GGGGAGGAGCAGAGGTGGAAAGG + Intronic
971294982 4:25379934-25379956 GTGGAAATGGAGATTTAGAATGG + Intronic
973304870 4:48635094-48635116 GGGAAGAAGCAGAGGTGGAAGGG + Intronic
973839322 4:54844865-54844887 GTGGAGAAGCAGGGATGAAATGG - Intergenic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
975257128 4:72250571-72250593 GTGAAGAAGGTGACTTAGAAAGG - Intergenic
975535931 4:75450405-75450427 ATGGGGAAGCAGGGGTAGAACGG + Intergenic
975570758 4:75815481-75815503 GTGCAAAAGCAAAGTGAGAAAGG - Intergenic
975948457 4:79738203-79738225 GGGGAGTAGTAAAGTTAGAAAGG - Intergenic
976564875 4:86541476-86541498 GGGGAGAAGAAGTGGTAGAAAGG + Intronic
976771525 4:88658189-88658211 GGGCAGAAGAAGAGTTAGAGTGG + Intronic
978221658 4:106283439-106283461 GTTGAGAAGAAGAGTACGAAGGG + Intronic
978476203 4:109134147-109134169 GATGAAAGGCAGAGTTAGAAAGG + Intronic
978844780 4:113260175-113260197 GTGAAGAAGCAAAGTAAGAGTGG - Intronic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
981702388 4:147620680-147620702 GAGGAGAAGCAGTGAGAGAAAGG + Intronic
983323609 4:166226430-166226452 GTTGTAAATCAGAGTTAGAAAGG + Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984206869 4:176795590-176795612 GTGGAGAAAGAGAGGTAGCAGGG + Intergenic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984456634 4:179977490-179977512 GAGGAGAGGGAGAGGTAGAAAGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984706829 4:182853430-182853452 GTGGTGAACCAGAGGAAGAAAGG + Intergenic
986286036 5:6359924-6359946 GTGGACACGCAGAGTGAGCACGG + Intergenic
987193807 5:15505008-15505030 GTAGAGCAGCAGAGTTACCAAGG - Intronic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
987742394 5:21927128-21927150 GTAGAGAGGCAGAGTTAGCCAGG + Intronic
988425451 5:31058380-31058402 AAGAAGAAGCAGAGTTATAATGG + Intergenic
988625613 5:32871454-32871476 CTGGGAAAGCAGAGATAGAAAGG + Intergenic
989662823 5:43817556-43817578 GTGGAGAGGAAGAGATAGCAAGG - Intergenic
991252800 5:64582476-64582498 GAGGACAAGCAGAGTCAGAGGGG - Intronic
992834795 5:80629751-80629773 GTGGAGAAGCTGGGTTTGGAAGG - Intronic
993219520 5:85073060-85073082 GTGGAGCAGTAGATGTAGAAGGG - Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
994714665 5:103307098-103307120 GTGGAGAAGGAGAAGAAGAAGGG + Intergenic
995098599 5:108270955-108270977 GTGGAGAAGGAGAGGGGGAAAGG - Intronic
997376884 5:133403745-133403767 CTGGAGAAGCAGAGTTGGAAGGG + Intronic
997627973 5:135344105-135344127 GTGGAGATGTATAGCTAGAAAGG - Exonic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
1001406201 5:171479457-171479479 GAGGAGGAGGAGAGGTAGAAGGG - Intergenic
1001584674 5:172825622-172825644 GTGAAGAAGCAGAGTTATTCTGG + Intergenic
1002382669 5:178841380-178841402 TTGGAGAAGGAGAGGAAGAAGGG - Intergenic
1003424384 6:5987938-5987960 GTGGAGAAGCCCACATAGAAAGG - Intergenic
1003550580 6:7098997-7099019 GTGGAGAAGGGGTTTTAGAAGGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1005308082 6:24533030-24533052 GTTGAGAAGCAAAGTAAGAAAGG + Intronic
1005995467 6:30928449-30928471 GTGGTGGGGCAGAGTGAGAAGGG + Intergenic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1008225014 6:48904446-48904468 GAGGAGAAGAAGAAGTAGAAGGG - Intergenic
1009943120 6:70312549-70312571 GTGGAGCAGCAGAGATGGAAAGG + Intergenic
1010061400 6:71626645-71626667 GAGGAGAAGCAAATTTGGAAAGG - Intergenic
1010067256 6:71697983-71698005 GAGGAAAAGCAAAGTAAGAAAGG - Intergenic
1012559836 6:100566985-100567007 GTTGAGATACAGAGTTAGATGGG - Intronic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1017563895 6:155663529-155663551 GTGGAGAAGGACAGGAAGAAAGG + Intergenic
1019923247 7:4175954-4175976 GTGGAGACGCAGCGTTTGAGAGG - Intronic
1020446545 7:8274904-8274926 GGTAAGAAGCAGGGTTAGAAAGG - Intergenic
1020903729 7:14038820-14038842 GTGAAGATGCAGAGATACAAAGG + Intergenic
1021230893 7:18086036-18086058 GAAGGCAAGCAGAGTTAGAAGGG - Intergenic
1022237565 7:28476915-28476937 GTGGAAAAGCAGAATTTTAATGG - Intronic
1022431837 7:30331623-30331645 GTGGAGAGGCAGTATTTGAAGGG + Intronic
1022513883 7:30963480-30963502 GTGGAGATGGAGGGTTGGAATGG - Intronic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024773996 7:52760984-52761006 TTAGAGAAGCAGAATTTGAAAGG + Intergenic
1024920145 7:54546285-54546307 GTGGGGAAGGAGAGGGAGAAAGG + Intronic
1026100424 7:67379538-67379560 ATGGAGCAACAGAGATAGAAGGG + Intergenic
1026245906 7:68619275-68619297 CGGGAGAAGCAGAGTTAATAGGG + Intergenic
1027814394 7:82950603-82950625 GTGGAGAAGCAGTTCCAGAAGGG + Exonic
1028421946 7:90642957-90642979 CTGGAGATGCAAAGTGAGAAAGG + Intronic
1028788678 7:94827432-94827454 GTTGCAAAGCAGAGTTAGAAGGG + Intergenic
1028974739 7:96899846-96899868 GTGGAAAACCAAAGTTAAAATGG - Intergenic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030105228 7:105981692-105981714 GTGGAGATGCTGGGTGAGAAAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031097963 7:117443546-117443568 GTGGTGAAGGTGAGGTAGAAAGG + Intergenic
1032937639 7:136751780-136751802 TTACAGAAGCAGAGATAGAATGG + Intergenic
1033588145 7:142789379-142789401 ATGCAGAAGTGGAGTTAGAATGG - Intergenic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034524360 7:151647549-151647571 GTGCAGAGGCAGATTTTGAAGGG + Intronic
1034898838 7:154895007-154895029 GTGGAGAGGAGGAGTTAAAAAGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1038858501 8:31359708-31359730 GTTGAAAATCAGAGTTAGGAGGG - Intergenic
1039174864 8:34792420-34792442 TTGGAGAAGCAGAGATAGCATGG - Intergenic
1040399545 8:47034574-47034596 CAGGAGAAGCAGAGAAAGAAAGG + Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040980308 8:53240187-53240209 GTGGGGAAACTGAGTTAAAAGGG + Intronic
1041623180 8:59997409-59997431 GTGGGGAAACACAGTTACAAGGG + Intergenic
1043097011 8:75988206-75988228 TTAGATAAGTAGAGTTAGAATGG + Intergenic
1043928733 8:86066863-86066885 ATAGAAAAGCAGAGTTGGAAAGG - Intronic
1044263730 8:90158286-90158308 GTTGAGAACCAGAGTTTTAAAGG + Intergenic
1045265454 8:100614941-100614963 CTGGGGAAGCAAAGTGAGAATGG + Intronic
1045300125 8:100903621-100903643 GTGGAGAAGCAGAGGGCGATAGG - Intergenic
1046155030 8:110277276-110277298 TTGGAGAGGCAGAGGTAAAATGG + Intergenic
1048004091 8:130404621-130404643 GTGGAGCAGCTGAGTTAGTATGG + Intronic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049864325 8:144924043-144924065 GGGAAGAAACGGAGTTAGAAGGG + Intergenic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1050045536 9:1540556-1540578 GAGGAGAACCAGAGCAAGAAAGG - Intergenic
1050723229 9:8615109-8615131 GTGGCTAAGCTGAGTTAGAGTGG - Intronic
1052747818 9:32458006-32458028 CTAAAGAAGCAGACTTAGAAAGG + Intronic
1053312211 9:37027090-37027112 TCGGAGAAGCAGAGAAAGAAAGG - Intronic
1055636758 9:78286783-78286805 AGAGAGAAGCAAAGTTAGAAAGG + Intergenic
1056748037 9:89321772-89321794 TTGAAGAGGAAGAGTTAGAAAGG + Intronic
1057745495 9:97747697-97747719 GGTGAAAAGCAGAATTAGAATGG - Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059927219 9:119221862-119221884 GTGTGGAAGCAGAGTTTGAAAGG + Intronic
1060271625 9:122146907-122146929 GTGGAGCAGCACAGGTAGCAAGG - Intronic
1060365039 9:123003030-123003052 GTGGGAAAGGAGAGGTAGAATGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060704673 9:125787367-125787389 GTGATGAAGTAGAGTTTGAAGGG + Intronic
1061656301 9:132093169-132093191 ATGGAGGAGCAGAGGTAGATGGG + Intergenic
1061732929 9:132630658-132630680 GTGGAGAAGTAAAATTAAAAAGG - Intronic
1061927963 9:133815485-133815507 GTGGTGAAGAACAGTCAGAAGGG - Intronic
1062185014 9:135213472-135213494 GTGAAGAACAAGAGTTGGAAGGG + Intergenic
1185976852 X:4730922-4730944 ATTGAAAATCAGAGTTAGAAGGG - Intergenic
1186435771 X:9542239-9542261 TAGGAGAAGCACAGTTGGAAAGG - Intronic
1187446496 X:19365391-19365413 GTGGAGAAACAGGGATAAAAAGG - Intronic
1188380145 X:29481630-29481652 GGGGTGAGGCAGAGTTAAAATGG - Intronic
1188538835 X:31227045-31227067 GTGGAGAAGGAGGATTAGAAAGG - Intronic
1189710555 X:43807255-43807277 TAGGAGAGGCAGAGCTAGAATGG - Intronic
1190991863 X:55559432-55559454 GAGGAGAAACAAAGTTTGAAAGG + Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1194976323 X:100400289-100400311 TTGGAGAATCAGTGTTACAATGG - Intronic
1195681118 X:107547367-107547389 GTGGAGAAGGGGAAGTAGAAGGG - Intronic
1197512516 X:127388063-127388085 GTAGAGAAGCAGAGCTATATAGG + Intergenic
1198266811 X:135017125-135017147 GTGGGGAAGCAGTGATAGGAAGG + Intergenic
1198682162 X:139194733-139194755 GTGGGGAAGCAGCGTTAAGATGG - Intronic
1199105583 X:143862870-143862892 CAGGAAAAGCAGAGGTAGAAGGG - Intergenic