ID: 1178283777

View in Genome Browser
Species Human (GRCh38)
Location 21:31307728-31307750
Sequence CTCTGGACAAGTGAGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178283777 Original CRISPR CTCTGGACAAGTGAGGGGTA AGG Intronic
900209506 1:1447038-1447060 GCCTGGACAAGGGAGGGGAAGGG + Intergenic
900219323 1:1498900-1498922 GCCTGGACAAGGGAGGGGAAGGG + Intergenic
904880458 1:33692709-33692731 ATCTGGGCCAGTGAGGTGTATGG + Intronic
905104948 1:35558602-35558624 CTCTGAAGAAGGGAGGGGAAAGG + Intronic
905804276 1:40864443-40864465 ATCTGGAGATGTGGGGGGTAAGG + Intergenic
906506553 1:46383896-46383918 GGCTGGACAAGGGAGGGGAAGGG + Intergenic
908592484 1:65648830-65648852 CTCTGGACATGTGGGGATTATGG - Intergenic
908698967 1:66877225-66877247 CTTTTGACAAGTGAGGAGAAGGG - Intronic
909014337 1:70366995-70367017 ATTTGGACAAGGGAGGGGAAGGG + Intronic
909457980 1:75871283-75871305 CCCTGGAAAAGTGAGGATTATGG + Intronic
910057017 1:83045407-83045429 CTCTTGACATGTGAGGATTATGG + Intergenic
911676293 1:100662134-100662156 CCCTGGACCAGTGAGTAGTAAGG + Intergenic
912989713 1:114473352-114473374 ACCTGGACAAGGGAGGGGAAGGG + Intronic
914753450 1:150550413-150550435 CCCTGGAGAAGTGAGGGGTGGGG - Intronic
914880600 1:151543751-151543773 CTCTGGACAACTGGGGGCCAAGG - Intronic
916693021 1:167209216-167209238 CTCATGACAGGTGAGGGGTCTGG + Intergenic
917025474 1:170637085-170637107 CTCCTGAAAAGTGAAGGGTAAGG - Intergenic
919828382 1:201520331-201520353 CTCTGGACAGCTGCGGTGTAAGG - Intergenic
920457695 1:206113543-206113565 CTCTACACAAGTGAGGGCTGAGG + Intronic
921009162 1:211123898-211123920 CTAGGGACACGTGAGAGGTAGGG + Intronic
921542179 1:216429831-216429853 CTCTGGACCATTGAGGGCTAGGG + Intergenic
1063346862 10:5319682-5319704 TTCTGGACAGGTGCTGGGTAGGG + Intergenic
1065191295 10:23211505-23211527 CTCTGGAAAAGTGTGTGTTACGG - Intronic
1067094444 10:43289819-43289841 CTCCTCACAGGTGAGGGGTAGGG - Intergenic
1067669917 10:48309832-48309854 CTCTGGTCAAGTCAATGGTATGG + Intronic
1067678523 10:48409320-48409342 CACTGGAAAAGTAAGGGGTTTGG + Intronic
1068350420 10:55837280-55837302 GTCTGGACTAGTGAGGGGCAGGG + Intergenic
1070506575 10:77118611-77118633 GGCTGGGCATGTGAGGGGTAGGG - Intronic
1071873496 10:89819227-89819249 CTCTGGACCTGTGATGGGAAGGG + Intergenic
1074378641 10:112960400-112960422 CTCTGGACAAGTGAGGGCTGAGG + Intronic
1074961226 10:118447842-118447864 CACAGGACAGGGGAGGGGTATGG - Intergenic
1076539823 10:131206859-131206881 CTCTGGCCAAGCGAGTGGTGCGG + Intronic
1078480640 11:11672397-11672419 CTCTGGTGAAGTGAGAGCTAAGG - Intergenic
1078527111 11:12109938-12109960 CTCTGGAGCTGTGGGGGGTAAGG + Intronic
1081751368 11:45513536-45513558 CTCTGGAGCAGGGAGGGGTAGGG + Intergenic
1082268242 11:50142740-50142762 CTCTGGACAGGTGATGGGAGCGG - Intergenic
1083175430 11:60946880-60946902 CTCTGTAGGAGGGAGGGGTATGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1083755477 11:64789623-64789645 CTCTGGAGGAGAGAGGAGTAGGG + Exonic
1084037803 11:66523617-66523639 CTCTTGCCAAGTGGGGGCTAGGG - Intronic
1084477871 11:69399052-69399074 CTGTGGGCACGTGAGGGGTGGGG - Intergenic
1084538635 11:69773765-69773787 CTCTGGACTAGAGAAGGGAAGGG + Intronic
1086895667 11:92309294-92309316 GGCTGGAGAAGTGAGGGGGAGGG - Intergenic
1087640502 11:100750263-100750285 ACCTGGACAAGGGAGGGGAAGGG + Intronic
1087640543 11:100750508-100750530 ACCTGGACAAGGGAGGGGAAGGG + Intronic
1088117367 11:106327646-106327668 TTCTTGACTAGTGAGGGGCAAGG + Intergenic
1088719805 11:112582205-112582227 CTCTGGACAGGGGAGGGCCAAGG + Intergenic
1089065690 11:115660279-115660301 CTCCCGACCAGTGAGGGGGACGG + Intergenic
1089141537 11:116288719-116288741 TTCTTGACAAGTGAGGGTTACGG + Intergenic
1092532272 12:9354328-9354350 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1092847313 12:12595837-12595859 ATCTGGACAAGGGAGGGGAAGGG + Intergenic
1093254965 12:16855680-16855702 CTCTGGATGACTGAGGGGTTTGG - Intergenic
1093272623 12:17082843-17082865 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1095162988 12:38938236-38938258 CACTGGACAAGGGAGGAGAAGGG + Intergenic
1096571578 12:52526447-52526469 CTCTGGACAGGGGAGGGGTGGGG - Intergenic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096773636 12:53951329-53951351 CTCTGGACAGACCAGGGGTAAGG + Intergenic
1097288812 12:57897004-57897026 CTCGGGACCAGGGAGGGGCATGG + Intergenic
1099728698 12:86469036-86469058 CTCTGGTTATGTGAGGGGAAAGG - Intronic
1099798379 12:87426273-87426295 CACTGGACAAGGGAGGGGATGGG - Intergenic
1100307177 12:93361516-93361538 CTCTGGACCTGAGAGGGGTTTGG - Intergenic
1102013133 12:109631322-109631344 CTCTGGGCAAGTGAGAGGAGAGG - Intergenic
1103597305 12:122031545-122031567 CTCTGTACAAGTGAGGGCACAGG + Intronic
1104806749 12:131594323-131594345 TTCTTGACATGTGAGGGGTGGGG + Intergenic
1105225919 13:18431421-18431443 CACTGGATAAGAGAGGGGAAAGG - Intergenic
1105318770 13:19296020-19296042 CTGTGGAAAAGTGAGAGGTGTGG + Intergenic
1105406784 13:20138976-20138998 CTCTGGACAAGTAAGTGGATAGG - Exonic
1106222117 13:27754930-27754952 ACCTGGACAAGGGAGGGGAAGGG - Intergenic
1107320744 13:39185073-39185095 CTGCGGAGAAGTGAGGGGTGGGG + Intergenic
1107698536 13:43023852-43023874 CACTGAACAAGTGAGCGCTAGGG - Intronic
1109508988 13:63343981-63344003 CTCTGAACAAGTGACGGGCTAGG + Intergenic
1110056982 13:70985751-70985773 CTCTGGACCAGTGATGGGAGGGG + Intergenic
1113215413 13:108034975-108034997 ATCTCGACTAGTGAGAGGTAAGG + Intergenic
1114010367 14:18359769-18359791 CACTGGATAAGGGAGGGGAAAGG - Intergenic
1114236502 14:20828383-20828405 ATTTGGACAAGGGAGGGGAAGGG + Intergenic
1115932180 14:38509039-38509061 CTCTGGACATGTGATGGGAGAGG + Intergenic
1116124624 14:40767607-40767629 CTCTGGACAGGTGGGGATTACGG - Intergenic
1116242676 14:42366300-42366322 CGGTGGAGAAGTGAGTGGTAAGG + Intergenic
1116961019 14:50968535-50968557 TTCTTGACCAGTGAGGGGTGAGG - Intergenic
1118067477 14:62207437-62207459 CTCTGGACCTGTGATGGGAAGGG + Intergenic
1119252827 14:73171547-73171569 ATTTGGACAAGGGAGGGGAAAGG + Intronic
1120232430 14:81855038-81855060 CACCGGACAAGGGAGGGGAAGGG + Intergenic
1120239833 14:81937216-81937238 ATCTGCACAAGTGTGGGCTATGG - Intergenic
1120307635 14:82790610-82790632 CCCTGGAGTAGTGAGGGGAAAGG + Intergenic
1120378053 14:83734526-83734548 CTCTTGACATGTGAGGATTATGG - Intergenic
1121000381 14:90447892-90447914 CTATGGACCAGTGACGGCTATGG + Intergenic
1121000908 14:90451553-90451575 CTGGGGACAAGTAAGGGGTGGGG - Intergenic
1121109077 14:91300189-91300211 CTCTGCAGAAGTGAGGGGCATGG + Intronic
1122082717 14:99277161-99277183 CTCTGTATATGTGAGGGGTGGGG - Intergenic
1124133579 15:27011884-27011906 CTCTGGAAAATTGAGGTGCATGG + Intronic
1128458395 15:67846649-67846671 CTCTTGACACGTGAGGATTATGG - Intergenic
1129926777 15:79371494-79371516 CTCTAGCCAAGTGAGGAGAATGG + Intronic
1130329375 15:82909309-82909331 CACTCGACAAGGGAGGGGAAAGG + Intronic
1132087869 15:98922771-98922793 CTCTGGACATGTGAGAGCTCAGG - Intronic
1132302906 15:100787554-100787576 CTCCGGAAAAGTCAGGGGGATGG - Intergenic
1132559502 16:586974-586996 CTCTGTCCAAGTGAGGGGCTTGG - Intergenic
1133269348 16:4602856-4602878 CTCTGCACTAGTGTGGGTTAGGG - Intergenic
1134887651 16:17808056-17808078 CTCATGACAGGTGAGGGGTGTGG + Intergenic
1135949731 16:26902914-26902936 GTCTGGAAGAGTGATGGGTAGGG + Intergenic
1136381466 16:29898020-29898042 CTCTGGAGAAGGAAGGGGTGTGG - Intronic
1138296622 16:55891246-55891268 ACCTGGACAAGGGAGGGGAAGGG - Intronic
1138339917 16:56281825-56281847 CACTGGACCAGTGGGGGGGATGG + Intronic
1138531450 16:57636564-57636586 CTCAGGCTATGTGAGGGGTAGGG - Intronic
1141297789 16:82785897-82785919 ATTTGGACAAGAGAGGGGAAGGG + Intronic
1142175371 16:88642756-88642778 CTCCGCACAAGTGAGGGGAAGGG + Intergenic
1142665396 17:1460341-1460363 CTCTGGGGAAGTGGGGGGTGGGG + Intronic
1145778648 17:27546940-27546962 CTCTGGGCACCTGAGGGGCATGG + Intronic
1145786531 17:27597391-27597413 CGCTGGCCAGGTGAGGGGTTGGG - Exonic
1147866885 17:43559164-43559186 CTCTGGGCAAGGCAGGGGCAAGG + Intronic
1149574660 17:57702978-57703000 CCCTGGACAAGTATGGGGTGAGG - Intergenic
1149920237 17:60651199-60651221 CACTGAAAAAGTGAGAGGTAAGG + Intronic
1150639046 17:66937350-66937372 CTGTGGGCCAGTGAGGGGTCAGG + Intergenic
1150669685 17:67181880-67181902 CTTTGTACAAGTGAGAGGAATGG - Intronic
1151955514 17:77378268-77378290 CTTTGGAGGAGTGAGGGGTATGG + Intronic
1152690826 17:81716981-81717003 CTCTGCACAAGGAAGGGGTGAGG - Exonic
1154157734 18:11957040-11957062 ACCTGGACAAGGGAGGGGAAGGG - Intergenic
1158119239 18:54030052-54030074 CCTTGGGCAATTGAGGGGTATGG - Intergenic
1158210878 18:55048440-55048462 CCCTGGAGGAGTGAAGGGTAAGG + Intergenic
1158354231 18:56598524-56598546 CACTGGAGAAATGAGGGGCATGG + Exonic
1159876032 18:73812397-73812419 CTATGGAAAAGAGAGGGGGAGGG + Intergenic
1159907378 18:74107772-74107794 CTCTGGAAAAGGGAGGGGAAAGG + Intronic
1161221075 19:3118536-3118558 CCCTGGCCCAGTGAGGGGAAAGG + Intronic
1164736404 19:30544443-30544465 CTCTGGAGCAGTGAGGGCCAAGG + Intronic
1165115925 19:33528725-33528747 CAGTGGTCATGTGAGGGGTAGGG + Intergenic
1165132539 19:33641704-33641726 CTCAGGGCAAAGGAGGGGTATGG + Intronic
1165673586 19:37701573-37701595 ATTTGGACAAGGGAGGGGAAGGG - Intronic
1166118768 19:40672290-40672312 GTCTGGACAGGTGACGGGTAAGG - Intronic
1167124639 19:47540805-47540827 CCCTGGACAAGTGAGTGGGGAGG - Intronic
1168078979 19:53995451-53995473 ATCTGGAAAAGTGCAGGGTAAGG - Intronic
925479378 2:4253090-4253112 CTCTGGAGAAGAGAGGGAGATGG - Intergenic
925626761 2:5849137-5849159 CTCTGAACAAGTGGGAGGCACGG - Intergenic
926756684 2:16242051-16242073 CTCTGGACAGATGATGGGTGTGG + Intergenic
927452825 2:23223609-23223631 CTCTGGACACCTGAGTGGTGGGG - Intergenic
928560536 2:32480035-32480057 CTTTTGAAAAGTAAGGGGTATGG - Intronic
930626980 2:53709120-53709142 CTCTGGGCCTGTGATGGGTAAGG - Intronic
931216094 2:60246251-60246273 CACTGAACAACTGAGGGGCAGGG - Intergenic
933840695 2:86283821-86283843 CTCATGACCAGTGAAGGGTAAGG + Intronic
934486188 2:94713843-94713865 CTCTTGACACATGAGGGTTATGG - Intergenic
936391428 2:112078088-112078110 CTCTGGAAGAGTGTGAGGTAAGG + Intronic
936466148 2:112752931-112752953 GTCTGGTCAAGAGAGGGCTAAGG - Intronic
936948601 2:117954201-117954223 CTCTGCTCAAATGAGGTGTATGG + Intronic
938526555 2:132139556-132139578 CACTGGATAAGGGAGGGGAAAGG + Intergenic
940303702 2:152202855-152202877 ATTTGGACAAGGGAGGGGAAGGG - Intergenic
940352007 2:152701555-152701577 CACTGGACAAGGGAGGGAAAGGG - Intronic
943303229 2:186229654-186229676 CTCTGGACCTGTGATGGGAAGGG - Intergenic
943864706 2:192915130-192915152 ACCTGGACAAGGGAGGGGAAGGG + Intergenic
945483142 2:210365446-210365468 GCCTGGACAAGGGAGGGGAAGGG + Intergenic
946359990 2:219213557-219213579 CCCTGGACAGGTGAGGGCCAGGG + Intronic
947102587 2:226637306-226637328 CCCTGGGCCAGTGAGGGGTCGGG + Intergenic
947498029 2:230653022-230653044 ACCTGGACAAGGGAGGGGAAGGG - Intergenic
948106949 2:235421904-235421926 ATCTGGACCAGAGAGGGGTCTGG + Intergenic
948912038 2:241009664-241009686 CCCCGGACAGGGGAGGGGTAAGG - Intronic
948922826 2:241073703-241073725 CTTTGGAGAAGTGAGGGGTGAGG - Intronic
1169215707 20:3793503-3793525 CTCTGGGCCAGTGAGGGGGGAGG - Intronic
1169654846 20:7911691-7911713 CTCTGCCCAAGTGTGGGGGAGGG - Intronic
1169943044 20:10958242-10958264 CTCTAGACAAGAAAGGGGTCAGG - Intergenic
1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG + Intergenic
1173476509 20:43363672-43363694 CTCTGCACAAGGGCGGGGGATGG - Intergenic
1175691388 20:61068242-61068264 CTCAGGGCATGTGAGGGGAACGG - Intergenic
1175846619 20:62063193-62063215 CTCTGGACAGGGCAGGGGTGGGG - Intronic
1176136381 20:63523861-63523883 ACCTGGACAAGGGAGGGGAAGGG + Intergenic
1176769974 21:13060445-13060467 CACTGGATAAGAGAGGGGAAAGG - Intergenic
1177086294 21:16709253-16709275 CCCATGACAAGTGAGGGTTATGG + Intergenic
1178283777 21:31307728-31307750 CTCTGGACAAGTGAGGGGTAAGG + Intronic
1179096671 21:38322258-38322280 CTCTTGAAAAGTGAGGGGAAAGG + Intergenic
1179102658 21:38367979-38368001 CTCTGGACCCGTGATGGGAAGGG + Intergenic
1179649664 21:42799553-42799575 ACCTGGACAAGTGAGGGAAAGGG + Intergenic
1180517065 22:16154382-16154404 CACTGGATAAGGGAGGGGAAAGG - Intergenic
1181329898 22:22081747-22081769 CTCGGGACCTGTGAGGGGTATGG + Intergenic
1181332776 22:22107100-22107122 CTCAGGACAAGTTATGGGTCAGG + Intergenic
1181629714 22:24144253-24144275 CTGTGGACATGTGATGGGGAGGG + Intronic
1182449299 22:30409273-30409295 CTATGGAGAGGTGAGGGGCAGGG + Exonic
1182739208 22:32554726-32554748 CACCGGACAAGGGAGGGGAAGGG - Intronic
1183114067 22:35676047-35676069 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1183557702 22:38543980-38544002 ATCTGAACAAGGGAGGGGAAGGG - Intronic
1184074103 22:42165172-42165194 CTCTGGACCAGTTTGGGGAAAGG + Intronic
1184078236 22:42197688-42197710 CTCTGGAAAATTGAGATGTATGG - Intronic
1184472041 22:44701802-44701824 CTGTGTTCAGGTGAGGGGTACGG + Intronic
1184912540 22:47546044-47546066 CACTGGACAGGTGAGGGCCAGGG + Intergenic
1185272215 22:49934832-49934854 CTCTGCACCAGTGAGGGGCCGGG + Intergenic
950855555 3:16101445-16101467 ACCTGGACAAGGGAGGGGAAGGG + Intergenic
954412707 3:50377978-50378000 CTCTGGACAAGGAAGGGGTGGGG - Intronic
954480979 3:50801179-50801201 ACCTGGACAAGGGAGGGGAAGGG + Intronic
955523060 3:59793672-59793694 CTTTGGTCAAGTGAGGGGACAGG + Intronic
957652271 3:83023282-83023304 CTCTGGACAATTGAATGATATGG + Intergenic
960853379 3:122078513-122078535 CTCTGGACCAGAGAAGGGAAAGG - Intronic
960960100 3:123064725-123064747 CTCTGGAGAGGGGAGGGGTGAGG + Intergenic
961319769 3:126064498-126064520 CTCTGGACAGGTGAGGACCACGG - Intronic
961487581 3:127227542-127227564 CTCTGGCCAGGAGAGGGGCAGGG + Intergenic
961542821 3:127611597-127611619 CTGGGGACAAGTGAGGGAGAAGG - Intronic
961581998 3:127890958-127890980 ACCTGGACAAGGGAGGGGAAGGG - Intergenic
961829988 3:129618459-129618481 CTCTGGACAGGTGGGAGGAAGGG - Intergenic
963226592 3:142868775-142868797 CACTTGACAAGGGAGGGGAAGGG - Intronic
966065712 3:175819036-175819058 CTCCAGACAAGGGAGGGGAAGGG + Intergenic
966457078 3:180129235-180129257 CTTTGGACAAGGGAAGGGAAGGG + Intergenic
968015911 3:195332625-195332647 CTCTTGACACGTGAGGATTATGG - Intronic
969157326 4:5222950-5222972 CTCTGGGCCTGTGATGGGTACGG - Intronic
971163143 4:24154954-24154976 CTCTGGTCAAGTGATGGGAAAGG + Intergenic
971448762 4:26779997-26780019 CTCTGGACATGCCAGGGCTAAGG + Intergenic
971985129 4:33812373-33812395 CTCTTGACACGTGGGGAGTATGG - Intergenic
972697603 4:41463540-41463562 ATTGGGAGAAGTGAGGGGTAGGG - Intronic
974763350 4:66307808-66307830 CTCTGGGCCTGTGATGGGTAGGG - Intergenic
976870060 4:89780807-89780829 CTCTGGAGACTTGAGGGGAAGGG + Intronic
978196458 4:105978148-105978170 CTCTGCAGGAGTGTGGGGTAAGG + Intronic
981519266 4:145644894-145644916 CTTGTCACAAGTGAGGGGTAGGG - Intronic
983454453 4:167945413-167945435 CCTTGGACAAGTGTGGGGAAAGG - Intergenic
984617308 4:181913435-181913457 CACCGGACAAGGGAGGGGAAGGG + Intergenic
986254155 5:6087902-6087924 CTCTGCCCCAGTGAGGGGCAGGG - Intergenic
988206091 5:28137040-28137062 TCCTGGACAAGGGAGGGGAAGGG + Intergenic
988390859 5:30628331-30628353 ATCAGGACAGGTGAGGGGTCTGG + Intergenic
988684844 5:33516181-33516203 CACTCAACAAGTGAGTGGTAGGG - Intergenic
989388600 5:40877618-40877640 AGCTGGACAAGGGAGGGGAAGGG + Intergenic
990339530 5:54808709-54808731 GTTTGGAAAAGTGAGGGGTCAGG + Intergenic
991418614 5:66417480-66417502 TTCTGGACAATTGAGGAATATGG + Intergenic
992002783 5:72451907-72451929 CTCTGGACCAGGGAGGAGAAGGG - Intronic
993054782 5:82969242-82969264 ACCTGGACAAGGGAGGGGAAGGG + Intergenic
993991303 5:94661197-94661219 CTCTGGGCCAGTGAGGACTAAGG + Intronic
994416622 5:99480292-99480314 CTCTGGGGAATTGAGGGGAAGGG - Intergenic
994463350 5:100094879-100094901 CTCTGGGGAATTGAGGGGAAGGG + Intergenic
994878094 5:105451018-105451040 CTCTGGAGATGTGATGGGAAGGG - Intergenic
995318383 5:110802621-110802643 TTCTAGACAAGTAAGTGGTAAGG - Intergenic
995407703 5:111819402-111819424 ACCTGGACAAGGGAGGGGAAGGG - Intronic
997434243 5:133862703-133862725 TTCTTGACTAGTGAGGGGTGAGG + Intergenic
998823281 5:146076157-146076179 CTGAGAACAAGTGAGGGGCAGGG - Intronic
999366859 5:151028921-151028943 CAGTGGACCAGTGAGGGGTGAGG - Exonic
1000372096 5:160547037-160547059 CACCGGACAAGGGAGGGGAAGGG + Intergenic
1000796443 5:165670744-165670766 CCATAGACAACTGAGGGGTAGGG + Intergenic
1005853906 6:29845770-29845792 CCCTGGACAAGGAAGGGGAAGGG - Intergenic
1007731590 6:43950912-43950934 CTGTGGCCATGTGAGAGGTATGG + Intergenic
1007770137 6:44185665-44185687 ATTTGGACAAGGGAGGGGAAGGG - Intergenic
1007776555 6:44227333-44227355 CTCAGGACAGGTAAGGGGTAAGG + Exonic
1010397149 6:75405635-75405657 CACTTGACAAGGGAGGGGAAGGG + Intronic
1013058943 6:106612894-106612916 GTTTGGACAAGGGAGGGGAAGGG - Intronic
1013814587 6:114082945-114082967 CCTTGGACAAGGGAGGGGAAGGG - Intronic
1014110252 6:117612715-117612737 ACCTGGACAAGGGAGGGGAAGGG + Intergenic
1015333071 6:132003935-132003957 CACTGGACAAGGGAAGGGAAGGG - Intergenic
1017198492 6:151727682-151727704 CCCTAGACAAGTGGGGGTTATGG - Intronic
1018085971 6:160301360-160301382 CTCTGAATAAGTGAGGAGTAAGG + Intergenic
1018585307 6:165350673-165350695 CCCATGACAAGTGAGGGTTAGGG - Intronic
1019919519 7:4154521-4154543 CTGGGGACAAGTGAGGGCTCCGG + Intronic
1020550369 7:9596629-9596651 CTCTGGGCATGTGATGGGAAGGG - Intergenic
1020745670 7:12075294-12075316 CACTGGACAAGGGAGGGAAAGGG - Intergenic
1023141286 7:37104900-37104922 ATCTGGACAAATGAGAGGAATGG + Intronic
1023436074 7:40141884-40141906 ACCTGGACAAGGGAGGGGAAGGG + Intronic
1023798083 7:43810505-43810527 ACCTGGACAAGGGAGGGGAAAGG - Intergenic
1023798527 7:43813579-43813601 ACCTGGACAAGGGAGGGGAATGG - Intergenic
1023799763 7:43823744-43823766 ACCTGGACAAGGGAGGGGAAGGG - Intergenic
1023882085 7:44326294-44326316 CTTTGGAGAAGTGAGGGGGAAGG - Intronic
1024038927 7:45534245-45534267 CTCTGGTCCAGCTAGGGGTATGG + Intergenic
1024047954 7:45597791-45597813 CTCTGGAGAAGGGTGGGGTGGGG + Intronic
1024623779 7:51187166-51187188 CTCTAGACAAGTGAGTGGTTTGG - Intronic
1029641412 7:101822478-101822500 CGCAGGACAAATGAGGGGAACGG - Intronic
1031469629 7:122153548-122153570 CTCTTGACATGTGAGGATTATGG + Intergenic
1033080265 7:138290013-138290035 CACAGGACAAGTGAGGGGAAGGG - Intergenic
1033096410 7:138435500-138435522 GCCTGGACAAGGGAGGGGAAGGG + Intergenic
1033884750 7:145931790-145931812 CTCATGACAAGTGAGGATTATGG - Intergenic
1034040792 7:147874587-147874609 CTCTGGGCCAGTGATGGGAAGGG + Intronic
1034528554 7:151681385-151681407 CTCTGGACTACAGAGGGGGAAGG + Intronic
1035373860 7:158395273-158395295 CCCTGCACAAGTGAGGGGTGAGG + Intronic
1036188626 8:6648730-6648752 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1037122872 8:15310353-15310375 CTCTGGACAAGTGACAAGTGGGG - Intergenic
1037460421 8:19102973-19102995 CTGTGGACAGGTGAGGGCTCTGG - Intergenic
1037892974 8:22633654-22633676 ATCTGGACAGTTGAGGGGAATGG - Intronic
1038592976 8:28857632-28857654 CTCTGAAAAAGTGACGAGTATGG + Intronic
1039056389 8:33540468-33540490 CTCTGGACAAGTGGCAGGTCCGG + Intergenic
1041479152 8:58298955-58298977 ATTTGGACAAGAGAGGGGAAAGG + Intergenic
1043981302 8:86643012-86643034 CTCTAGACAACTGAGCAGTAAGG - Intronic
1044268066 8:90206440-90206462 ATTTGGACAAGGGAGGGGAAAGG - Intergenic
1044934746 8:97282838-97282860 CTCTGGACAAGACAGAGGTATGG + Intergenic
1047928269 8:129701904-129701926 GTCTGCACAAGTGTGGGGAAGGG + Intergenic
1048111527 8:131473415-131473437 CTCTGGACCTGTGATGGGAAGGG - Intergenic
1052215028 9:25956232-25956254 CTCTGGATATGTGAAGAGTATGG + Intergenic
1052981578 9:34453966-34453988 CTCTAGATCAGTGAGGTGTATGG + Intronic
1053705266 9:40746919-40746941 CACTGGATAAGGGAGGGGAAAGG + Intergenic
1053753767 9:41281115-41281137 CTCTGGACAAGTGCTGGGAAGGG - Intergenic
1054259288 9:62845475-62845497 CTCTGGACAAGTGCTGGGAAGGG - Intergenic
1054332489 9:63774562-63774584 CTCTGGACAAGTGCTGGGAAGGG + Intergenic
1054415343 9:64870526-64870548 CACTGGATAAGGGAGGGGAAAGG + Intergenic
1057507698 9:95649375-95649397 CTCTGGAAACGTGTGGGTTAAGG - Intergenic
1060028267 9:120191567-120191589 CTTTGGCCAAGTGAGGGATAAGG + Intergenic
1060991035 9:127849245-127849267 ATCTGAACAAGGGAGGGGAAGGG - Intronic
1061766785 9:132886535-132886557 CAGGGGACAGGTGAGGGGTAGGG + Intronic
1062284507 9:135767153-135767175 CTCTGGACATGGCAGGGGGAGGG - Intronic
1062366396 9:136211500-136211522 CTCTGGACAAGCGTGGGGTCAGG - Intronic
1202799493 9_KI270719v1_random:162873-162895 CTCCGGACAAGTGCTGGGAAGGG + Intergenic
1185582615 X:1222572-1222594 AGCTGGACAAGGGAGGGGAAGGG + Intergenic
1189146550 X:38661054-38661076 CTCTGGACAGGTGAGAAGGATGG + Intronic
1189408150 X:40744306-40744328 CCCTGGACATGTGAGGATTATGG + Intergenic
1190729667 X:53217278-53217300 CTGGGGACAGGTAAGGGGTAAGG + Intronic
1191889706 X:65927417-65927439 ATCTGGACAAGGGAGGGGAAGGG + Intergenic
1191890311 X:65932584-65932606 ACCTGGACAAGGGAGGGGGAGGG + Intergenic
1192090950 X:68155372-68155394 CTCTAGACATGTGGGGAGTATGG - Intronic
1194206340 X:91015653-91015675 CTCTGGTCATGTGATGGGAAGGG + Intergenic
1196045826 X:111255327-111255349 AGTTGGACAAGAGAGGGGTACGG + Intronic
1196136943 X:112220446-112220468 CTCTGGGCAAGTGATGGGAGTGG + Intergenic
1196529549 X:116769138-116769160 CTCCAGACAAGTGAGGGGTGTGG + Intergenic
1199178936 X:144829240-144829262 CCCTTGACAAGTGAGGATTATGG - Intergenic
1200552092 Y:4590474-4590496 CTCTGGTCATGTGATGGGAAGGG + Intergenic