ID: 1178296195 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:31412457-31412479 |
Sequence | TAATGCCTGATGATCTGAGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1178296195_1178296198 | 4 | Left | 1178296195 | 21:31412457-31412479 | CCACCTCAGATCATCAGGCATTA | No data | ||
Right | 1178296198 | 21:31412484-31412506 | CTTATAAGGTGCACGAAGCCAGG | No data | ||||
1178296195_1178296197 | -10 | Left | 1178296195 | 21:31412457-31412479 | CCACCTCAGATCATCAGGCATTA | No data | ||
Right | 1178296197 | 21:31412470-31412492 | TCAGGCATTAGATTCTTATAAGG | No data | ||||
1178296195_1178296199 | 12 | Left | 1178296195 | 21:31412457-31412479 | CCACCTCAGATCATCAGGCATTA | No data | ||
Right | 1178296199 | 21:31412492-31412514 | GTGCACGAAGCCAGGCACAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1178296195 | Original CRISPR | TAATGCCTGATGATCTGAGG TGG (reversed) | Intronic | ||