ID: 1178296196

View in Genome Browser
Species Human (GRCh38)
Location 21:31412460-31412482
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178296196_1178296199 9 Left 1178296196 21:31412460-31412482 CCTCAGATCATCAGGCATTAGAT No data
Right 1178296199 21:31412492-31412514 GTGCACGAAGCCAGGCACAGTGG No data
1178296196_1178296198 1 Left 1178296196 21:31412460-31412482 CCTCAGATCATCAGGCATTAGAT No data
Right 1178296198 21:31412484-31412506 CTTATAAGGTGCACGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178296196 Original CRISPR ATCTAATGCCTGATGATCTG AGG (reversed) Intronic