ID: 1178296196 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:31412460-31412482 |
| Sequence | ATCTAATGCCTGATGATCTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1178296196_1178296199 | 9 | Left | 1178296196 | 21:31412460-31412482 | CCTCAGATCATCAGGCATTAGAT | No data | ||
| Right | 1178296199 | 21:31412492-31412514 | GTGCACGAAGCCAGGCACAGTGG | No data | ||||
| 1178296196_1178296198 | 1 | Left | 1178296196 | 21:31412460-31412482 | CCTCAGATCATCAGGCATTAGAT | No data | ||
| Right | 1178296198 | 21:31412484-31412506 | CTTATAAGGTGCACGAAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1178296196 | Original CRISPR | ATCTAATGCCTGATGATCTG AGG (reversed) | Intronic | ||