ID: 1178296198

View in Genome Browser
Species Human (GRCh38)
Location 21:31412484-31412506
Sequence CTTATAAGGTGCACGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178296195_1178296198 4 Left 1178296195 21:31412457-31412479 CCACCTCAGATCATCAGGCATTA 0: 847
1: 1053
2: 687
3: 346
4: 231
Right 1178296198 21:31412484-31412506 CTTATAAGGTGCACGAAGCCAGG 0: 1
1: 0
2: 2
3: 5
4: 78
1178296196_1178296198 1 Left 1178296196 21:31412460-31412482 CCTCAGATCATCAGGCATTAGAT 0: 605
1: 945
2: 803
3: 457
4: 288
Right 1178296198 21:31412484-31412506 CTTATAAGGTGCACGAAGCCAGG 0: 1
1: 0
2: 2
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178296198 Original CRISPR CTTATAAGGTGCACGAAGCC AGG Intronic
902221409 1:14968213-14968235 CTAATAAGGAGCACGCAACCTGG + Intronic
903741606 1:25561830-25561852 CTTTTAGGGTGCACAAAGCTGGG + Intronic
909921875 1:81391989-81392011 CTTATGAGGAGCATGAAGCATGG + Intronic
912158099 1:106947077-106947099 CATATGAAGTTCACGAAGCCTGG - Intergenic
914350774 1:146837955-146837977 CTTATAAGGAGCACGCAGCCTGG - Intergenic
916491199 1:165303978-165304000 CATCTAAGGTGCACAAACCCTGG + Intronic
920615575 1:207489354-207489376 CTTATGAGATGCCTGAAGCCAGG + Exonic
1075749596 10:124754358-124754380 CTTATAAAGAGCACTAACCCCGG - Intronic
1076947227 10:133659652-133659674 CTGAAGAGGTGCATGAAGCCTGG - Intergenic
1090550607 11:127815757-127815779 CTCATCAGGTCCAGGAAGCCTGG + Intergenic
1092012787 12:5129128-5129150 CTTATAAGAAGCAAGAAGCAAGG - Intergenic
1100386674 12:94110323-94110345 ATTATAAGTTGCATGAAGGCAGG + Intergenic
1101625892 12:106440815-106440837 CTTAGAAGCTTCACGAAGGCAGG + Intronic
1103161369 12:118732051-118732073 CTCATAAGGAGCACGCAACCTGG - Intergenic
1104115446 12:125744981-125745003 CTTATAAGGTGAACAAATACTGG + Intergenic
1108102653 13:46973867-46973889 CTTATATTCTGCACTAAGCCAGG - Intergenic
1108225593 13:48285766-48285788 CTTGTAAGGTTCATGAAGGCAGG + Intergenic
1113122729 13:106941850-106941872 CTCATAAGGAGCACATAGCCTGG + Intergenic
1118261255 14:64248908-64248930 CTTCTAAGCTGCCCAAAGCCTGG + Intronic
1121842904 14:97149654-97149676 CTTCTAAGTGCCACGAAGCCAGG - Intergenic
1122347888 14:101071680-101071702 CTGAGAAGGTGCACAGAGCCTGG + Intergenic
1202921289 14_KI270723v1_random:32205-32227 CTGAAGAGGTGCATGAAGCCTGG - Intergenic
1202923621 14_KI270724v1_random:5375-5397 CTGAAGAGGTGCATGAAGCCTGG + Intergenic
1125741717 15:41969878-41969900 CTTGGAATGTGCAGGAAGCCAGG + Intronic
1129412269 15:75356506-75356528 CCTAGAAGGGGCAGGAAGCCAGG + Exonic
1132505712 16:307626-307648 CTCACAAGGTGCACACAGCCTGG + Intronic
1134639588 16:15819534-15819556 CTCATAAGGAGCACACAGCCTGG - Intronic
1151275362 17:73030059-73030081 CTCTTAAGGAGCACGCAGCCTGG + Intronic
1153975132 18:10262617-10262639 CTTATAAGTAGCACTAAGCCGGG - Intergenic
1155914203 18:31539952-31539974 CTCATAAGGAGCACGCAACCTGG - Intronic
1157937234 18:51886600-51886622 CTTAGAAGGTTCAGGAAACCAGG + Intergenic
1160412121 18:78682211-78682233 CTCATGAGGAGCACGCAGCCTGG - Intergenic
1162684470 19:12370253-12370275 CTCATAAGGTGCATGCAACCTGG + Intergenic
1163864395 19:19760421-19760443 CTTAAAAGGTGCAAGTATCCAGG + Intergenic
1164555190 19:29245884-29245906 ATTAAAAGGTGCACGGGGCCAGG + Intergenic
925180403 2:1813646-1813668 CTTCTAAGGAGCCCGCAGCCCGG - Intronic
928477461 2:31644482-31644504 CTCATAAGGTGCACACAACCTGG + Intergenic
934939695 2:98491564-98491586 CTGAAAAGGTGCAGCAAGCCAGG + Intronic
937363270 2:121243671-121243693 CTTATAAGGAGCACGCAGCCTGG - Intronic
938904821 2:135827635-135827657 CTCATAAGGAGCACGCAACCTGG + Intronic
942081080 2:172399964-172399986 CTTATAAGGTGCATAGAGCCGGG + Intergenic
942738571 2:179146153-179146175 CTTATAAGGAGCACACAACCTGG - Intronic
943618474 2:190120224-190120246 CTCATAAGGTGCGCGAAACCTGG - Intronic
945081980 2:206095079-206095101 AATATAAGCTCCACGAAGCCTGG + Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946216257 2:218186080-218186102 CATATAAGCTTCACGAAGGCAGG + Intergenic
1177791990 21:25732210-25732232 CTTATAATGAGTACAAAGCCAGG + Intronic
1178296198 21:31412484-31412506 CTTATAAGGTGCACGAAGCCAGG + Intronic
1178426912 21:32485964-32485986 CTTACAAGGTGGAAGAGGCCTGG - Intronic
949956472 3:9273126-9273148 CTGATAAGGGGCACGCAACCTGG + Intronic
955927008 3:64017024-64017046 ATTATAAAGTGAAAGAAGCCAGG + Intronic
956463271 3:69493715-69493737 ATTATAAGCTTCACGAAGGCAGG + Intronic
957080229 3:75630764-75630786 CTGAAGAGGTGCATGAAGCCTGG + Intergenic
962154713 3:132934169-132934191 TTTATAAGTTCCACGAAGTCAGG + Intergenic
965747448 3:171940111-171940133 CTTAAAATGTGAACTAAGCCTGG - Intergenic
973540371 4:51929143-51929165 CTTATAAGAAGCAAGAAGCTGGG - Intergenic
973740611 4:53916162-53916184 AATATAAGTTGCACGAAGGCAGG + Intronic
976571848 4:86621112-86621134 CTTAGAAGGCACACAAAGCCTGG + Intronic
976669485 4:87636381-87636403 CTTAAAAGGTGGCTGAAGCCAGG + Intergenic
979186356 4:117799344-117799366 CTTAAAAATTGCACAAAGCCAGG + Intergenic
983398553 4:167234218-167234240 CAAATAAGGGGTACGAAGCCAGG + Intronic
985450685 4:190060452-190060474 CTGAAGAGGTGCATGAAGCCTGG - Intergenic
990323564 5:54652480-54652502 CTTATAAGGAGCATGCAACCCGG - Intergenic
994121123 5:96114145-96114167 GTTTTAAGGTGCACTAAACCTGG + Intergenic
998613277 5:143712357-143712379 CTTCTCAGGTGGAGGAAGCCTGG - Intergenic
1000155846 5:158550889-158550911 CTTATAAGCTGTACAAAACCAGG - Intergenic
1001066143 5:168536437-168536459 CTTTTAAAGTGCAGGAGGCCAGG + Intergenic
1015088975 6:129331169-129331191 CTTAGAAGGTGCAGGTGGCCGGG - Intronic
1018376433 6:163217763-163217785 CTCACAAGGTGCACACAGCCTGG - Intronic
1019263140 7:93553-93575 CTCATAAGGAGCACGCAACCTGG - Intergenic
1021879726 7:25083002-25083024 CTTATGGGGTGGACCAAGCCAGG - Intergenic
1023764289 7:43496472-43496494 CTTAAGAGATGCAGGAAGCCAGG + Intronic
1024230693 7:47361151-47361173 CTGAGAAGGTGCACTGAGCCTGG - Intronic
1024492257 7:49998524-49998546 CTTATAAGAAGCAAGGAGCCTGG - Intronic
1029242536 7:99174229-99174251 CTCATAAGGAGCATGCAGCCTGG - Intronic
1032142416 7:129344782-129344804 CTTAAAAGGGGCAGGAAGCGGGG + Intronic
1039997494 8:42546516-42546538 ATTATACTGTTCACGAAGCCTGG + Exonic
1044172723 8:89075626-89075648 CTTATAAGGAGCACGCAACCTGG - Intergenic
1048703118 8:137116921-137116943 GTTATTAGGTGCACGAAGTGAGG + Intergenic
1050131248 9:2415051-2415073 CTCATAAGAAGCACGCAGCCTGG + Intergenic
1051700817 9:19821736-19821758 CTTACAAGGGGCAGGAAGCAAGG + Intergenic
1187765108 X:22632835-22632857 ATTATAGGTTGCAAGAAGCCTGG - Intergenic
1189335312 X:40167615-40167637 CTTTTATTGTGCACGCAGCCTGG + Intronic
1190776013 X:53552783-53552805 CCTCTAAGGTACAGGAAGCCAGG + Exonic
1192359198 X:70427711-70427733 CTTCTAAGATGCACAAAGCAGGG + Intronic
1195335365 X:103848292-103848314 CTCATAAGGTGCCCCAACCCTGG + Intergenic