ID: 1178297384

View in Genome Browser
Species Human (GRCh38)
Location 21:31421653-31421675
Sequence TCCCCAAGCTTTTTATCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3336
Summary {0: 1, 1: 0, 2: 96, 3: 1266, 4: 1973}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178297384_1178297390 25 Left 1178297384 21:31421653-31421675 CCTGGTGATAAAAAGCTTGGGGA 0: 1
1: 0
2: 96
3: 1266
4: 1973
Right 1178297390 21:31421701-31421723 AGCATGCCAGCCGGCTGCAGTGG 0: 1
1: 0
2: 2
3: 31
4: 387
1178297384_1178297385 2 Left 1178297384 21:31421653-31421675 CCTGGTGATAAAAAGCTTGGGGA 0: 1
1: 0
2: 96
3: 1266
4: 1973
Right 1178297385 21:31421678-31421700 ACTGCCCCAGAGCATTCAGAAGG 0: 1
1: 0
2: 4
3: 48
4: 391
1178297384_1178297389 16 Left 1178297384 21:31421653-31421675 CCTGGTGATAAAAAGCTTGGGGA 0: 1
1: 0
2: 96
3: 1266
4: 1973
Right 1178297389 21:31421692-31421714 TTCAGAAGGAGCATGCCAGCCGG 0: 1
1: 0
2: 1
3: 55
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178297384 Original CRISPR TCCCCAAGCTTTTTATCACC AGG (reversed) Intronic
Too many off-targets to display for this crispr