ID: 1178297968

View in Genome Browser
Species Human (GRCh38)
Location 21:31426882-31426904
Sequence GTTTTTGAGGGGCTTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 505}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178297968 Original CRISPR GTTTTTGAGGGGCTTGGGGT GGG Intronic
900758404 1:4454077-4454099 GGTGTTGAGTGGCTTGGTGTGGG - Intergenic
901000220 1:6145357-6145379 GTTTTTGAGGGGCTTAGGATCGG - Intronic
901427415 1:9191272-9191294 GATTTTAAGGGGTTTGGAGTGGG - Intergenic
902829191 1:18998952-18998974 GTTTTTTAGTTGCTTAGGGTGGG - Intergenic
902844934 1:19102767-19102789 GTATTTGTGGGGCATGGGGTTGG - Intronic
902875620 1:19339070-19339092 GTTTGGGAGTTGCTTGGGGTTGG - Exonic
902978469 1:20106688-20106710 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
903246049 1:22016330-22016352 TTTTTTGCGGGGGTTGGGGACGG + Intergenic
903484029 1:23676444-23676466 CTTGTGGAGGTGCTTGGGGTTGG + Intergenic
906075985 1:43052510-43052532 TTTTTTGAGGGGATTGGGCTGGG + Intergenic
906823837 1:48957657-48957679 GTTTTTTAGGGGCTGGGGAGTGG - Intronic
907247331 1:53116516-53116538 GTTAGTGATGGGCTTAGGGTGGG + Intronic
907422631 1:54357419-54357441 GTTTTTTGGGGGCTGGGGGTAGG + Intronic
907439370 1:54469428-54469450 GATTTGGAGGGGCCTGGGGGCGG + Intergenic
907741532 1:57170795-57170817 GTTTTGGAGGGGTCAGGGGTTGG + Intronic
908240101 1:62181777-62181799 TTTGTTGAGGGGCTTGAGGTGGG + Intergenic
908343184 1:63203836-63203858 ATAATTGAGAGGCTTGGGGTAGG + Intergenic
908757181 1:67479680-67479702 GCATTTGAGGGGCTGGGGGACGG + Intergenic
908853273 1:68395380-68395402 GATTTGGAGGGGCCAGGGGTGGG - Intergenic
908912601 1:69089474-69089496 GTTTTTTAGGGGGATGGGGAAGG + Intergenic
910449261 1:87329590-87329612 GTGTTTGGGGGGGTGGGGGTGGG + Intronic
910509064 1:87983564-87983586 GTTTCAGAGGGGCTTGTGATCGG - Intergenic
910629599 1:89341536-89341558 TTTCTTGAGGGTTTTGGGGTCGG - Intergenic
910651690 1:89575067-89575089 GTTTTTGGGGGGCTTGGGAAAGG + Intronic
912940486 1:114040333-114040355 GATTTTGAGGGGTTTGGAGTGGG + Intergenic
913344280 1:117792638-117792660 GTTGTTGAGGGGTTGGGAGTAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914695390 1:150073828-150073850 GTTAATGAGGGGGTTGGGGTGGG - Intronic
915080716 1:153349883-153349905 TTTTTGGAGCGGCTTGGGGAGGG + Intergenic
915168241 1:153960477-153960499 GTGTTCGAGGGGCTGGCGGTAGG - Exonic
915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG + Intronic
917108661 1:171521633-171521655 CTTTTTGAGGTGCTGGGGCTGGG + Intronic
917208880 1:172610322-172610344 GTATTTGAAGGGTTTGGGGGAGG + Exonic
917231660 1:172844588-172844610 GGAGTTGTGGGGCTTGGGGTTGG - Intergenic
917262879 1:173188895-173188917 GTTTTTGAGGGGGTAGAGATGGG + Intronic
918009852 1:180576698-180576720 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
918371750 1:183868048-183868070 TTTTTAGAAGGGCTTGGGGAAGG + Intronic
918475503 1:184919905-184919927 TTTTTTCAGGGGCTGGGGGAGGG + Intronic
918511235 1:185316598-185316620 GGTTTTGGGGGGCCTGGGTTAGG - Intronic
919039688 1:192367966-192367988 GTTATTGAGGGTCTTTGGCTGGG - Intergenic
919090463 1:192972878-192972900 GGTTTTCAGGGGCTGGGGTTGGG - Intergenic
920170534 1:204069727-204069749 GATTTTAAGGGGTTTGGAGTGGG - Intergenic
920247690 1:204600742-204600764 TTTTTTGAGGGGAGTGGGCTGGG + Intergenic
920314183 1:205065933-205065955 GGTTTTAAGGGAGTTGGGGTAGG - Intronic
921181952 1:212638276-212638298 GTGTTTGATGGGCTAGGAGTTGG - Intergenic
922280850 1:224122608-224122630 GTGTTGGCGGGGCTTGGGGGGGG - Intronic
922460540 1:225811529-225811551 ATTGTTGAGGACCTTGGGGTTGG + Intronic
922865743 1:228860212-228860234 GTTTTTTTGGGGGGTGGGGTGGG + Intergenic
923863273 1:237913941-237913963 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
924011497 1:239670257-239670279 TTTTTCCTGGGGCTTGGGGTGGG - Intronic
924066773 1:240231611-240231633 ATTTGTGAGGGGCTTGTAGTAGG + Intronic
924747135 1:246846747-246846769 TTTTTTGGGGGGATGGGGGTGGG + Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1064205618 10:13321217-13321239 GTTTTTGGGAGGCTGGGGCTAGG + Intronic
1064686713 10:17869146-17869168 GTTTTACAGGTACTTGGGGTAGG + Intronic
1065207829 10:23374080-23374102 GTTTTCAAGGGGTTTGGAGTGGG - Intergenic
1065673465 10:28147917-28147939 GTTTTTGTGGGGGTTGGGGGAGG - Intronic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1066448761 10:35509271-35509293 CTTTTTTGGGGGCTGGGGGTAGG + Intronic
1069250624 10:66261905-66261927 GTTTTTAAGGGTTTTGGAGTGGG - Intronic
1069411914 10:68162822-68162844 GTTTTTAAGGGTTTTGGAGTGGG + Intronic
1069570551 10:69492146-69492168 GGTTTGGAGGGGAATGGGGTGGG + Intronic
1070363419 10:75712799-75712821 GTAGTTGGGGGGCTGGGGGTGGG - Intronic
1071371897 10:84959927-84959949 GTTTTTAAGGGGTTTGGAGTGGG - Intergenic
1071492136 10:86143379-86143401 GTTTTTTGGGGGGATGGGGTAGG - Intronic
1071615980 10:87077008-87077030 TTTTTTGGGGGGGTAGGGGTGGG + Intronic
1071815784 10:89231583-89231605 GTTCTTCAGGGGCCTGAGGTGGG - Intronic
1071878024 10:89863572-89863594 GCTTTTGAGGGGAAAGGGGTGGG + Intergenic
1072664487 10:97383960-97383982 GTTTTTGTGAGGCACGGGGTAGG - Intronic
1072741073 10:97910035-97910057 GTTTACTAGGGGCTAGGGGTAGG + Intronic
1072932181 10:99675547-99675569 TTTTTTTAGGGGGGTGGGGTGGG + Intronic
1073205071 10:101764739-101764761 TTTTTTGAGGGGCGGGGGGATGG - Intergenic
1074203872 10:111264295-111264317 GGTTGTCAGAGGCTTGGGGTAGG - Intergenic
1075162259 10:120034611-120034633 GTTTTTGAGATTCTTGGGGAGGG + Intergenic
1077047072 11:551363-551385 GTTTCTGAGAAGCCTGGGGTGGG - Intronic
1077406014 11:2382875-2382897 GTTTCCGAGGGGCTTAGAGTAGG + Intronic
1078496609 11:11824179-11824201 GATTTGGAGGGGCCAGGGGTGGG - Intergenic
1078674111 11:13393390-13393412 CTTTTTAAGGGACTTGGGATTGG + Intronic
1078850358 11:15157768-15157790 GTATTAGATGGGCTTGTGGTGGG + Intronic
1079408902 11:20168245-20168267 CTGTTTGTGGGGCTTGGGGATGG - Intergenic
1080055765 11:27904708-27904730 TTGTTTGAGGGGCTCAGGGTGGG + Intergenic
1081193187 11:40129357-40129379 TTTTTTGAGGGGGATGGGGTAGG + Intronic
1081633588 11:44705719-44705741 TTTATTGAGTGCCTTGGGGTAGG - Intergenic
1081800417 11:45855156-45855178 ATTTTTGTGGGGGTGGGGGTGGG - Intronic
1081828954 11:46089796-46089818 GTTTTGGAGGGGGTGGGGGGCGG + Intronic
1081916012 11:46730615-46730637 GTTATTGAGGGGCTTGAGGCAGG + Intronic
1082191705 11:49253206-49253228 GTTTTTGAAAGGATTGGGATTGG - Intergenic
1083812205 11:65112298-65112320 GTCTTCGAGGGGCCTGGGGGCGG + Intronic
1083871465 11:65490801-65490823 TTTTATGAGGGGCAGGGGGTGGG - Intergenic
1084063182 11:66688828-66688850 GTTTTGGAGGTGCTTGTGTTTGG - Exonic
1084728189 11:71055763-71055785 GTTTTCTAGGGGCTGGGGGAGGG + Intronic
1086674418 11:89587812-89587834 GTTTTTGAAAGGATTGGGATTGG + Intergenic
1087245942 11:95837036-95837058 TTTTTTGAGAGCCTTGGGGTAGG - Intronic
1088330345 11:108644503-108644525 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1089009546 11:115121331-115121353 GTTTTCGAGGGGTCAGGGGTGGG + Intergenic
1089167287 11:116486878-116486900 GTTTTTCAGGGGCTGGGAGGTGG - Intergenic
1089857028 11:121554706-121554728 GTATTTGAGGGGCTTGGGGTGGG + Intronic
1091729384 12:2868805-2868827 GTTCTTCAAGGGCTTGGGTTGGG - Intronic
1091898262 12:4121973-4121995 GTTGATGAGGAGCCTGGGGTTGG + Intergenic
1094105748 12:26809661-26809683 GGTTTTCAGGGGCTTGGCGGGGG + Intronic
1094430603 12:30365673-30365695 GTTTTCGAGGGTTTTGGAGTAGG + Intergenic
1094678640 12:32647787-32647809 ATTTTTGAGGGGGATGGGGATGG - Intergenic
1096379770 12:51146377-51146399 GTTTTTTGGGGGTATGGGGTGGG - Intronic
1096984328 12:55745976-55745998 GTGTTTGGGGGGGTTAGGGTGGG + Intronic
1097181602 12:57175051-57175073 GATTTGGAGGGGTTTGGGGTGGG - Intronic
1097364100 12:58692012-58692034 ATTTTTGGGGGGGGTGGGGTGGG - Intronic
1098097392 12:66973286-66973308 GTTATTCAGGGGTTTGGGGTAGG + Intergenic
1098553188 12:71787723-71787745 GTTTTTGAGGAAGTTGGGGTGGG + Exonic
1098556121 12:71820908-71820930 GATTTCTAGGGGCTAGGGGTGGG - Intergenic
1099375892 12:81896110-81896132 GTTTTTGAGAGTCTGGGGGATGG - Intergenic
1099588125 12:84547090-84547112 GGTTATCAGGGGCTTAGGGTGGG - Intergenic
1101235121 12:102780915-102780937 TTTTTTGGGGGGCGTGGGGTGGG - Intergenic
1101527673 12:105546378-105546400 GATTTTGAGGGGTTTTGGGCAGG + Intergenic
1101641953 12:106592616-106592638 GTGGTTGAGGGGGCTGGGGTGGG - Intronic
1101791097 12:107928534-107928556 GATTTTGAGGGCCTAGGGGGTGG + Intergenic
1102016833 12:109653652-109653674 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1102409329 12:112703759-112703781 GTTTTTAAAGGTTTTGGGGTGGG - Intronic
1102514306 12:113436129-113436151 GCTTTTGGGGGGTTTGGGGGAGG - Intronic
1102656698 12:114487977-114487999 GTGGATGAGGGGCTTGGGCTGGG + Intergenic
1103027838 12:117588069-117588091 TTTTATGAGGGGCTGTGGGTGGG - Intronic
1103839392 12:123850346-123850368 TTTCTTGAGGGGTTTGAGGTGGG + Intronic
1103982774 12:124747257-124747279 GGTGTGGAGGGGCTTGGGGTTGG - Intergenic
1105756040 13:23465496-23465518 GTTTTTCAGGAGCTAGGGGAAGG + Intergenic
1106060693 13:26288581-26288603 GTGTTTGTGGGGGGTGGGGTGGG - Intronic
1106170108 13:27281225-27281247 GTGTTTGAGGGGCTGTGGCTGGG + Intergenic
1106263475 13:28089682-28089704 GGTTGTGAGGGGCTTGGGGTAGG + Intronic
1106660198 13:31791430-31791452 GACTTTCAGGGGCTTGGGCTTGG - Intronic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1107330163 13:39291087-39291109 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
1107514683 13:41117663-41117685 GGTTTTCAGGGGCTGGGGATAGG - Intergenic
1108510812 13:51154001-51154023 GGTTGTCAGGGGCTGGGGGTAGG - Intergenic
1109407220 13:61918144-61918166 ATTTGGGAGGGGCTTGGGGGTGG - Intergenic
1110693667 13:78461601-78461623 GTTTTTGATGGGGTGGGGGTGGG - Intergenic
1111198473 13:84903673-84903695 GGTTTTCAGTGGCTCGGGGTAGG + Intergenic
1111519285 13:89379157-89379179 GATTTTGATGGGCTTGGGATGGG - Intergenic
1111632471 13:90859878-90859900 TTTTCAGAGGGGCTTAGGGTAGG - Intergenic
1111730239 13:92065837-92065859 ATTTTTGAGGGGACTAGGGTAGG + Intronic
1111802707 13:92999405-92999427 TTTTTTGGGGGGGTGGGGGTGGG + Intergenic
1112020827 13:95369636-95369658 GTTTTTAAGGGTTTTAGGGTGGG + Intergenic
1112449419 13:99495460-99495482 GTCTGTGTGGGGCATGGGGTGGG - Intergenic
1112880772 13:104104066-104104088 TTTTTTGAGGGGGTGGGGGATGG + Intergenic
1113075023 13:106459734-106459756 TTATTTGTGGGGCTTGGGGGTGG + Intergenic
1113949903 13:114066158-114066180 TTTTTTGGGGGGTATGGGGTGGG - Intronic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1116441531 14:44960707-44960729 GTTTTTGGGGGGGTGGGGGTGGG - Intronic
1117353267 14:54901618-54901640 CTTTTTGCGGGGTTGGGGGTGGG + Intronic
1117701475 14:58417708-58417730 CTTTTTTAGGTGCTTGAGGTAGG - Intronic
1118338591 14:64876561-64876583 ATTTTTGGGGGGCATGGGGAAGG - Intronic
1119052559 14:71384346-71384368 GTTTGTGTGGGGCCTGGGTTTGG + Intronic
1119318978 14:73718363-73718385 CTTTTTCTGGGGCTTGGGGCAGG + Exonic
1119380690 14:74226288-74226310 GTTCTGGGGGGACTTGGGGTAGG - Intergenic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1121257122 14:92539165-92539187 GTTTCTGGGGATCTTGGGGTGGG + Intronic
1121596069 14:95163697-95163719 GTTTTTTAGGGTTTTGGAGTGGG - Intergenic
1122373622 14:101243344-101243366 TTTTTTTGGGGGGTTGGGGTGGG + Intergenic
1123071408 14:105644259-105644281 GTGTGTGAAGGGCCTGGGGTAGG + Intergenic
1123096838 14:105770875-105770897 GTGTGTGAAGGGCCTGGGGTAGG + Intergenic
1123191763 14:106578705-106578727 GTTTTAGACGGGCTCGGGGCTGG + Intergenic
1202843967 14_GL000009v2_random:149546-149568 TTTGTTGAGGGGCTTGAGGCGGG + Intergenic
1202913359 14_GL000194v1_random:139789-139811 TTTGTTGAGGGGCTTGAGGCGGG + Intergenic
1202879292 14_KI270722v1_random:42900-42922 TTTGTTGAGGGGCTTGAGGCGGG - Intergenic
1124440161 15:29679885-29679907 TTTTTTGGGGGGCGGGGGGTGGG + Intergenic
1125176125 15:36823801-36823823 TTTTTTTAGGGGATGGGGGTTGG + Intergenic
1125514678 15:40311415-40311437 GTTATAGAGGGGCTTGGAATGGG - Intergenic
1125668409 15:41451086-41451108 TTTTTTGAGGGGGTGGGGTTGGG - Intronic
1125756803 15:42070319-42070341 GGTTTTGGGGGGCTGGGGGATGG - Intronic
1125920454 15:43522390-43522412 GATTTTGCTGGGCTTGAGGTTGG - Exonic
1125970065 15:43904193-43904215 GTTTCTGGGGGGCCTGTGGTCGG + Intronic
1126690275 15:51283789-51283811 TTTGTTGAGGGGCCTGAGGTGGG - Intronic
1126835418 15:52659085-52659107 GTTTTAGAAGAGCTGGGGGTTGG - Intronic
1127916013 15:63455761-63455783 GGTTTTTAGGGGCTGGGGGTGGG - Intergenic
1127968688 15:63942654-63942676 GTGTGTTAGGTGCTTGGGGTGGG - Intronic
1128464595 15:67899494-67899516 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1128559570 15:68655779-68655801 CCTGTTGAGGGGCTTGGGGATGG - Intronic
1129125388 15:73436172-73436194 GCTTTCCAGGGGCTTGGGGGAGG + Intergenic
1129675381 15:77630428-77630450 GTTTTTTGGGGGGTTGGGGTGGG + Intronic
1129779961 15:78264015-78264037 ATTTTTTAGGGGGTTGGAGTGGG - Intergenic
1129962256 15:79697874-79697896 GTGTTTAAGGGGCTTAAGGTGGG - Intergenic
1130017482 15:80199043-80199065 GTTTTTTGGAGGCTTGGGTTGGG + Intergenic
1130761413 15:86824190-86824212 GTTTTTGGGGGGTATTGGGTAGG - Intronic
1131016754 15:89064015-89064037 GGTTGTCAGGGGCTTGGGGGAGG - Intergenic
1131998260 15:98154419-98154441 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
1133023511 16:2977278-2977300 GTTCTTGAGGGTCTTGCAGTCGG + Intronic
1133500529 16:6362168-6362190 TTTTTGGGGGGGCGTGGGGTGGG - Intronic
1133732519 16:8589505-8589527 GTATTTTAGGGACTTGGGGGAGG + Intronic
1133771600 16:8869714-8869736 GTATTTGAGGGGCGCGGGGAAGG + Intergenic
1134085864 16:11357051-11357073 GGTTCTGAGGGGCTTGCAGTGGG + Intergenic
1134484964 16:14650500-14650522 GTTTGCCAGGGGCTGGGGGTTGG - Intronic
1134796663 16:17044960-17044982 GGTTGCCAGGGGCTTGGGGTGGG - Intergenic
1134798103 16:17060064-17060086 GGTTTCCAGGGGCTTGGGGAAGG + Intergenic
1134855377 16:17514378-17514400 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1135070503 16:19347566-19347588 GGTTATCAGGGGCTTGGGGGAGG - Intergenic
1135424418 16:22325267-22325289 GTGTGTGAGGGGCTTTGGGCTGG + Intronic
1135846808 16:25926226-25926248 GGTTGTTTGGGGCTTGGGGTCGG - Intronic
1135915200 16:26599365-26599387 GTTTTTAAGGGTTTTGGAGTAGG + Intergenic
1136048627 16:27634940-27634962 GTTTTTAAGGGTTTTGGAGTAGG + Intronic
1136419918 16:30125418-30125440 TTTTTTGGGGGGGTGGGGGTGGG - Intergenic
1136491145 16:30609431-30609453 GTTTTGGTTGGGCTAGGGGTGGG - Intronic
1136601216 16:31290230-31290252 GGTTTCCAGGGGCTGGGGGTTGG + Intronic
1136610582 16:31362826-31362848 GGCTTTGAGGGCCTTGGGGGAGG + Intronic
1136707578 16:32202150-32202172 GGTGTTGGGGGGCTTGGGGGTGG + Intergenic
1136760332 16:32727260-32727282 GGTGTTGGGGGGCTTGGGGGTGG - Intergenic
1136807772 16:33143126-33143148 GGTGTTGGGGGGCTTGGGGGTGG + Intergenic
1137375468 16:47948274-47948296 TTTTTTGAGGGGGGTGGGGTGGG + Intergenic
1137963156 16:52905808-52905830 GGTTGTCAGGGGCTGGGGGTAGG + Intergenic
1138267770 16:55672088-55672110 GCCATTGAGGAGCTTGGGGTCGG - Exonic
1138531401 16:57636201-57636223 GCCTTTGAGGGTCTTGGGGGTGG + Intronic
1138823955 16:60295956-60295978 GTTTGTGTGGGGCATTGGGTGGG - Intergenic
1139108432 16:63857669-63857691 TTTTTTGAGTGGCTTAAGGTAGG - Intergenic
1139283004 16:65785806-65785828 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1139403389 16:66699292-66699314 TTTTTTGAGGGGGTGGGGTTGGG + Intergenic
1139850443 16:69948950-69948972 TTTTTTGAGGGGTCGGGGGTGGG + Intergenic
1139879427 16:70171862-70171884 TTTTTTGAGGGGTCGGGGGTGGG + Intergenic
1140321901 16:73960592-73960614 GGGTTTGAGGGGCTAGGGGAGGG + Intergenic
1140373097 16:74423686-74423708 TTTTTTGAGGGGTCGGGGGTGGG - Intergenic
1140835175 16:78787332-78787354 GGTTATGAGGGGCTGGGGGAAGG - Intronic
1141403191 16:83769087-83769109 GTTTTTGAGGGCTTTGGAGTGGG + Intronic
1141943980 16:87297395-87297417 GCTTTTGTGGGGCTTGGGACAGG + Intronic
1142055499 16:87993018-87993040 CTTTTTGAGGAGCATTGGGTCGG + Intronic
1142419276 16:89960609-89960631 GAAGCTGAGGGGCTTGGGGTCGG + Intronic
1203062486 16_KI270728v1_random:987582-987604 GGTGTTGGGGGGCTTGGGGGTGG - Intergenic
1142513749 17:413733-413755 GCCCTTGAGGGCCTTGGGGTCGG - Exonic
1142513782 17:413823-413845 GCCCTTGAGGGCCTTGGGGTCGG - Exonic
1142789968 17:2256233-2256255 TTTTTTGAGGGGTGAGGGGTTGG + Intronic
1143173795 17:4945132-4945154 CCTTTTGAGGGGCTTTGGGGTGG + Exonic
1143893845 17:10121806-10121828 TTTTTTGGGAGGCTTGGGGCTGG - Intronic
1144191133 17:12847382-12847404 GTCTTGGAGGTTCTTGGGGTGGG + Intronic
1144526363 17:15993913-15993935 GTTTTAGTGGGGTTTGGGGAAGG - Intronic
1144756267 17:17682134-17682156 GTCTTTGCGGAGCGTGGGGTGGG + Intronic
1145235572 17:21205711-21205733 AGTTTGCAGGGGCTTGGGGTTGG - Intronic
1146174232 17:30654703-30654725 GTTTTTAAGGGGTATGGAGTGGG + Intergenic
1146347687 17:32070730-32070752 GTTTTTAAGGGGTATGGAGTGGG + Intergenic
1146679370 17:34796095-34796117 GTTTTTGAGTGGCTTGAGAAGGG - Intergenic
1146897472 17:36554697-36554719 TTTTTTGAGGGGCTAGGGATGGG + Intronic
1147249955 17:39147341-39147363 GGTTTTATGGGGTTTGGGGTGGG - Intronic
1147643663 17:42020485-42020507 GCTTTTGGGGGGCTTGTGTTTGG + Intronic
1147703801 17:42412269-42412291 GTTTAAATGGGGCTTGGGGTGGG + Intronic
1147948904 17:44096122-44096144 GACTTTGTGGGGCTTGGGCTGGG - Intronic
1148412180 17:47477013-47477035 CTTTTTGAGGGGCTGGGTGGTGG - Intergenic
1149431025 17:56595766-56595788 TTTTTTGAGGGCGTTGGGGGGGG + Intergenic
1149498934 17:57136627-57136649 GTATTTGAGGTGCTTGGAGATGG + Intergenic
1149520119 17:57312385-57312407 GTGTTTGAGAGGCTCCGGGTGGG + Intronic
1149578609 17:57731375-57731397 TTTTTATAGGGGCTGGGGGTAGG + Intergenic
1150292121 17:63988108-63988130 GATTTTAGGGGGCTTGGGGAAGG - Intergenic
1150478984 17:65495313-65495335 ATTTTTGAGGGAGTGGGGGTGGG - Intergenic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1151426511 17:74034333-74034355 CTGACTGAGGGGCTTGGGGTGGG - Intergenic
1151455500 17:74223280-74223302 TTTTTTGGGGGGCGGGGGGTGGG + Intronic
1151826313 17:76526558-76526580 GGTTTTGTGGGGGTTGGGGGAGG - Intergenic
1152764867 17:82130808-82130830 TTTTTTGGGGGGGTGGGGGTGGG + Intronic
1153147325 18:2048063-2048085 GTTGGTGAAGGGCTTGGCGTTGG - Intergenic
1153447208 18:5187733-5187755 AGTTTTGAGGGACTAGGGGTGGG - Intronic
1154110190 18:11561149-11561171 GTTTTTCAGGGGCTGGGGTGGGG - Intergenic
1155553677 18:26994588-26994610 TTTTTTGCGGGGCTGGGGGGTGG + Intronic
1158974454 18:62698439-62698461 GTTTGTCAGGGGCTGGGAGTTGG - Intergenic
1160249657 18:77190509-77190531 TTTTTTGGGGGGCTGGTGGTTGG + Intergenic
1161422343 19:4182741-4182763 GTGTTTGCGGGGCTTGGGAAGGG + Intergenic
1161473846 19:4473831-4473853 GTTTTGGAGGGACTTGAGGGTGG + Intronic
1161593946 19:5141842-5141864 GTCTGGGAGGGGCTTGGGATGGG + Intronic
1162136620 19:8559323-8559345 GTTCTTGAGGGGGTGGGGGGTGG + Intronic
1162859865 19:13498475-13498497 GTTATTTGGGGGCTGGGGGTGGG + Intronic
1162860939 19:13505700-13505722 GTTTGTGGGGGGCTGGGGGGTGG - Intronic
1162988177 19:14285323-14285345 GTTTTTAAGGGGTATGGAGTGGG - Intergenic
1163809785 19:19423711-19423733 GTTGTAGAGGGGGTTGGGGATGG + Intronic
1163997686 19:21067542-21067564 TTTTTTGGGGGGAGTGGGGTGGG - Intergenic
1164237192 19:23347543-23347565 GTTTTTGAAGGTTTTGGGCTTGG - Intronic
1165068698 19:33242971-33242993 GCTTTGGTGGGGCTTGGGGGAGG + Intergenic
1165145884 19:33729778-33729800 GTTTTTAAGGGTTTTGGAGTGGG + Intronic
1165299036 19:34956007-34956029 GGTTTTGAGGGGCTGGGGAAGGG + Intergenic
1165722914 19:38092528-38092550 GTTTTGTAGGTGCTGGGGGTGGG - Intronic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
1202654909 1_KI270708v1_random:11908-11930 TTTGTTGAGGGGCTTGAGGCGGG - Intergenic
925798740 2:7575115-7575137 CTTTTTGAGGGGATTGGAGGGGG + Intergenic
927528634 2:23772727-23772749 TTTTTTGGGGGGATGGGGGTGGG + Intronic
928465697 2:31520396-31520418 GATTTGGAGGGGCCAGGGGTGGG + Intergenic
929163686 2:38859356-38859378 GGTTATGAGGGGCTGGGGGAAGG + Intronic
929507942 2:42542989-42543011 GTTTTTAAGAGTTTTGGGGTAGG + Intronic
930099549 2:47592232-47592254 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
930717761 2:54608760-54608782 GATTTTCAGCGGCATGGGGTTGG - Intronic
930737432 2:54793873-54793895 GCTATTGAGGGGCTAGGGGAAGG - Intronic
930919194 2:56730812-56730834 GGTTATGAGAGGCTGGGGGTGGG + Intergenic
932190671 2:69739409-69739431 TTTTTTTAGGGGGGTGGGGTGGG + Intronic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
933418463 2:82018472-82018494 TTTTTTGTGGGGCTGGGGGGTGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
935186751 2:100741497-100741519 TTTTTTGGGGGGATAGGGGTGGG - Intergenic
935289622 2:101599083-101599105 CTTTTTGAGGGTTCTGGGGTGGG - Intergenic
935334929 2:102007229-102007251 GTCTTTGGGGGGCATGGGGGAGG + Intronic
936064959 2:109323973-109323995 GTTTTCCAGGGGCTGGGGGAAGG - Intronic
936117667 2:109714959-109714981 TTTTTTGGGGGGGTGGGGGTGGG + Intergenic
936342737 2:111650711-111650733 GTTATTGATGGGATTGGGGGAGG + Intergenic
936415335 2:112303549-112303571 GGTTTTCAGGGGCTGGGGGCAGG - Intronic
936973241 2:118194832-118194854 GATTGTCAGGGGCTGGGGGTAGG + Intergenic
938225657 2:129614126-129614148 TGTTGTGAGGGGATTGGGGTGGG + Intergenic
938686263 2:133741499-133741521 GATTTGGAGGGGCCAGGGGTTGG - Intergenic
939020468 2:136952204-136952226 TTTTTTGGGGGGGTGGGGGTTGG - Intronic
940205707 2:151199152-151199174 GTTTTTCAAGGACATGGGGTGGG + Intergenic
941710363 2:168705465-168705487 GTTTGTGAGGGGTTGGGAGTAGG + Intronic
941839557 2:170065926-170065948 TTTTTTGCGGGGGGTGGGGTAGG - Intronic
941960074 2:171244715-171244737 GTTTGTAAGGGGTTTGGAGTGGG + Intergenic
942849721 2:180469895-180469917 GATTTTCAGGGACTAGGGGTAGG + Intergenic
944821994 2:203440849-203440871 GTTTTGGGGGAGCTTGGGGAGGG + Exonic
945346137 2:208719216-208719238 GTTTATCAGGGGCTGGGGATAGG - Intronic
945815366 2:214599208-214599230 CATTTTGAGGTGCTAGGGGTTGG + Intergenic
947118336 2:226795111-226795133 GTTGATGAGGGGGTGGGGGTGGG + Exonic
947195324 2:227559290-227559312 GTTTTTCAAGGCCTTGGAGTTGG + Intronic
948422324 2:237867478-237867500 ATTTTTGTGGGGGTGGGGGTGGG + Intronic
948873745 2:240816937-240816959 GTTCTTGAGGCCCTGGGGGTGGG + Intronic
1169024350 20:2355950-2355972 GGTTGTCAGGGGCTTGGGGTGGG + Intergenic
1169257703 20:4111428-4111450 GTGTTTGGGGGGCCTGGGGGAGG - Intergenic
1169319373 20:4618656-4618678 GGTTTTTAGGGGTTTGGAGTGGG + Intergenic
1170465546 20:16619385-16619407 GGTTTTCAGGGGTTTGGAGTGGG - Intergenic
1170801106 20:19591034-19591056 GGCCTTGAGGGGGTTGGGGTGGG - Intronic
1171102702 20:22400429-22400451 GGTTGCCAGGGGCTTGGGGTGGG - Intergenic
1173666946 20:44769755-44769777 GTTTAGGAGGGGCTGGGGGTGGG + Intronic
1173885988 20:46459174-46459196 TGCTTTGCGGGGCTTGGGGTAGG - Intergenic
1174026457 20:47580557-47580579 TTTTTTGGGGGGATGGGGGTGGG - Intronic
1174899048 20:54479370-54479392 CTATTTGAGGGGCTGGGGGAAGG + Intronic
1175331566 20:58168256-58168278 ATTTTTATGGGGCCTGGGGTGGG - Intergenic
1175996688 20:62815157-62815179 TTTTTTGAGGGGCTTGAAGGTGG + Intergenic
1176632720 21:9154466-9154488 TTTGTTGAGGGGCTTGAGGCGGG + Intergenic
1176640593 21:9300363-9300385 TTTGTTGAGGGGCTTGAGGCGGG - Intergenic
1177831818 21:26147854-26147876 TTTTTTGGGGGGGTTGGGGAGGG - Intronic
1178297968 21:31426882-31426904 GTTTTTGAGGGGCTTGGGGTGGG + Intronic
1179578372 21:42321680-42321702 GTTCTGGTGGGGCTTGGGCTGGG + Intergenic
1179599264 21:42465123-42465145 GTTTTTAAGGGTTTTGGCGTAGG + Intergenic
1179667068 21:42920220-42920242 GTTTTTGAAGGTTTTGGGCTTGG + Intergenic
1180234572 21:46450011-46450033 GCTTTTGAGGTGATTGTGGTGGG - Intergenic
1180349616 22:11789746-11789768 TTTGTTGAGGGGCTTGAGGCGGG - Intergenic
1180388587 22:12202494-12202516 TTTGTTGAGGGGCTTGAGGTGGG + Intergenic
1181292422 22:21806502-21806524 GCTTTTGAGGAGCTTGGGAGAGG - Intronic
1182194390 22:28500192-28500214 GGTTTTCAGGAGCTTGGGGTAGG - Intronic
1182422273 22:30254363-30254385 GTTTTAGGGAGGCTGGGGGTAGG - Intergenic
1182444712 22:30383340-30383362 ATTGGTGAGAGGCTTGGGGTGGG - Intronic
1182561149 22:31160304-31160326 GTATGTGAGGGGCTGGGGTTGGG + Intronic
1183285290 22:36958897-36958919 GTTTGTGGGGGGTTGGGGGTGGG - Intergenic
1184010927 22:41747720-41747742 TTTTTTGGGGGGGTGGGGGTGGG - Intronic
1184209558 22:43027523-43027545 CTACTTGAGGGGCTTGGGGAGGG - Intergenic
1184863045 22:47187559-47187581 GGTTTCTAGGGGCTGGGGGTAGG + Intergenic
949523173 3:4875901-4875923 CTTTTTGGGGGGCTTGGAGTGGG - Intronic
949835730 3:8267682-8267704 GTTTTTGAGAGACTTGAAGTTGG - Intergenic
950049579 3:9976887-9976909 GTATTTGAGTGGGGTGGGGTAGG - Intronic
950391603 3:12701156-12701178 GTTTCTAAGGGGTTTGGAGTGGG + Intergenic
950749090 3:15114719-15114741 GATTTTAAGGGGTTTGGAGTGGG - Intergenic
950781876 3:15399208-15399230 GTTTTTTGGGGGCGAGGGGTTGG - Intronic
951685296 3:25337207-25337229 TTTTTTGTGGGGGTGGGGGTTGG - Intronic
953332679 3:42066859-42066881 CTTTTTCAGGGGCTGGGGGGAGG + Intronic
953405492 3:42657731-42657753 GTTCTTGAGGTGTTTGGGGCTGG + Intronic
953678270 3:45020250-45020272 GGTTTCCAGGGGCTTGGGGTGGG - Intronic
953685905 3:45078268-45078290 GATTTGGAGGGGCCAGGGGTGGG + Intergenic
953795753 3:45984803-45984825 GGTTTTGAGGGACTTGTGGCAGG - Intronic
954134519 3:48575840-48575862 GTTGTTTAGGGGCTGGGGGTAGG - Intronic
954274979 3:49536128-49536150 GTTTGTGTTGGCCTTGGGGTGGG + Intergenic
955125813 3:56110993-56111015 GTTTTCAAGGGGGTGGGGGTAGG + Intronic
955909217 3:63843080-63843102 GTTTTTGGAGGGGTTGGGGCAGG - Intronic
956044997 3:65186238-65186260 GTTTGTCAGGGGTTTGGGGGTGG - Intergenic
956199806 3:66694455-66694477 GTTTTTGATGCGTTTGTGGTGGG + Intergenic
956368180 3:68529074-68529096 ATCTTTGAGTGGCATGGGGTAGG - Intronic
956755599 3:72383091-72383113 GTTGTTGAGGGGTTTGGGTGGGG - Intronic
956783019 3:72619228-72619250 GATTTTAGGTGGCTTGGGGTGGG + Intergenic
958414532 3:93858331-93858353 GATTTTTGGGGGGTTGGGGTTGG - Intergenic
958736114 3:98011098-98011120 TTTTTTGGGGGGGTTGGGGGAGG - Intronic
961153151 3:124656826-124656848 CTTTTTGTGGGGCTGGGGGGTGG + Intronic
961735757 3:129001424-129001446 GCTTTGGAGGGGCCTGGGGTAGG - Intronic
961802238 3:129460223-129460245 GGTTTTCAGGGGCTGGGGGTAGG - Intronic
961960016 3:130845154-130845176 GTTTTTGATGGATTTGGGGCAGG - Intergenic
962152250 3:132905042-132905064 GTTCTTAAGAGGCCTGGGGTTGG + Intergenic
962478410 3:135778010-135778032 GTACTGGAGGGGCTGGGGGTAGG - Intergenic
963359578 3:144253497-144253519 GGTTTTGAGGGGCATGGCATTGG + Intergenic
964627360 3:158772335-158772357 GTTTTTTATGGCCTTGGGGTAGG + Intronic
965386048 3:168047942-168047964 GATATTGAGGGGGCTGGGGTTGG - Intronic
965403493 3:168242268-168242290 GGTTTTGAGGGGCTGGGGGCAGG - Intergenic
966020452 3:175202968-175202990 GTTTTGGAGGGGTTTGGGCGGGG - Intronic
966434710 3:179870408-179870430 GTTTTTAAGGGTCTTGGAGTGGG - Intronic
967142837 3:186576684-186576706 TTGGTTGAGGGGCCTGGGGTGGG + Intronic
1202746300 3_GL000221v1_random:104661-104683 TTTGTTGAGGGGCTTGAGGCGGG + Intergenic
969913975 4:10472010-10472032 ATTTTTGAAGGGGTTGGGTTGGG + Intergenic
970008230 4:11429810-11429832 GGTTTTGAGGGGCGTGGGGTTGG + Intergenic
971442940 4:26709612-26709634 CCTGTTGAGGGGATTGGGGTGGG + Intronic
971482055 4:27123811-27123833 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
973309985 4:48698802-48698824 CTATTTGTGGGGGTTGGGGTGGG - Intronic
973538711 4:51911870-51911892 TTTTTAGAAGGGCTTGGGGCAGG - Intronic
974175257 4:58314446-58314468 GGTTTTGAGGGGTTAGGGATAGG - Intergenic
974288625 4:59902301-59902323 CTTTTGGTGGGGCTTGGGGAGGG + Intergenic
974876326 4:67707623-67707645 TTTTTTGGGGGGGGTGGGGTAGG + Intergenic
975514714 4:75233906-75233928 GCTTTTGAGGGCCTTGCGGTAGG - Intergenic
975514905 4:75236283-75236305 GCTTTTGAGGGCCTTGCGGTAGG + Intergenic
976197723 4:82549444-82549466 GGTTGTCAGGGGCTAGGGGTAGG + Intronic
977258137 4:94762866-94762888 TTTTTTGCGGGGCTGGGGGCTGG + Intronic
979690745 4:123555790-123555812 GTTGTTGAGGGACTAGGGATTGG + Intergenic
979832906 4:125322532-125322554 GTCTTTGAGGGGCCTGGGGAGGG - Intronic
980301998 4:131007632-131007654 GTTTTTGAGGACCTTGGGTAAGG - Intergenic
980642067 4:135594405-135594427 GGTTGTCAGGGGCTTGGGGGAGG - Intergenic
981367695 4:143922463-143922485 GGTTGTCAGGGGCTTGGGGAGGG - Intergenic
982385768 4:154800273-154800295 CTTTTTGAGGGGCAGGGGATAGG + Intronic
982455327 4:155602989-155603011 GGTTCTGATGGGCTTTGGGTGGG - Intergenic
983860678 4:172702494-172702516 AATTTTGAGGGGGTCGGGGTGGG - Intronic
984291658 4:177803157-177803179 GATTTTGGGGGGCTTGGGAAAGG - Intronic
1202755489 4_GL000008v2_random:58631-58653 TTTGTTGAGGGGCTTGAGGCGGG - Intergenic
985961347 5:3305601-3305623 GTGGGTGAGGGGCTGGGGGTGGG + Intergenic
986225796 5:5811024-5811046 GTTTTTAAGGGGGCGGGGGTTGG + Intergenic
986415312 5:7522345-7522367 GGTTTCCAGGGGCTAGGGGTTGG - Intronic
986612182 5:9580346-9580368 AATTGTGAGGGGCTTGGAGTTGG - Intergenic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
989305171 5:39946866-39946888 GAGTTTGAGAGGATTGGGGTGGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990718005 5:58660402-58660424 GTTTCTGCATGGCTTGGGGTGGG - Intronic
991056077 5:62322090-62322112 TTTTTAGAGGGGATTGGGGTAGG + Intronic
991077243 5:62554711-62554733 TTTTTTGGGGGGGTGGGGGTGGG + Intronic
992094095 5:73344413-73344435 GGTTTCCAGGGGCTGGGGGTGGG - Intergenic
992331896 5:75725555-75725577 GTTTTTAAAGGTCTTGGAGTGGG + Intergenic
992575220 5:78101425-78101447 ATTTTTGATGGGCTTGTGATAGG + Intronic
992778755 5:80109851-80109873 GTTTTATAGGGGCTGGGGGAGGG - Intergenic
994154660 5:96489661-96489683 GTTTTTGATAGTCTTGGGGAGGG - Intergenic
995727871 5:115201838-115201860 GTTTAGGAGGGGCTTAGGGGTGG - Intergenic
995835341 5:116395071-116395093 GTTTCTAAAGGGGTTGGGGTGGG - Intronic
995904394 5:117105975-117105997 ATTTTTGGGGGGTTTGGGGTGGG + Intergenic
996054580 5:118968932-118968954 GTTCCTGAGGGGCTTGGGAGTGG + Intronic
998192835 5:140042195-140042217 GTGGGTGAGGGGGTTGGGGTTGG - Intronic
998238217 5:140418562-140418584 GATTATGAGGGGCTGGGGGAAGG - Intronic
1000106579 5:158065526-158065548 GCTTAGGAGGGGTTTGGGGTGGG + Intergenic
1001169766 5:169407991-169408013 GTTTTTGATGGATTTGGGGCAGG + Intergenic
1001509565 5:172310020-172310042 GTTTTTGTCAGGGTTGGGGTTGG + Intergenic
1001616637 5:173048155-173048177 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1001696280 5:173672819-173672841 GACTTCGAGGGGCTTGGGGAGGG + Intergenic
1003491721 6:6628205-6628227 GTGGTTGAGGAGCTCGGGGTTGG - Intronic
1003580950 6:7340542-7340564 GTTTTTATTGGGGTTGGGGTGGG - Intronic
1003612106 6:7622942-7622964 GTGTGTGAGTGGGTTGGGGTGGG + Intergenic
1003858686 6:10301679-10301701 ATTTTTGAGGGGCAGGAGGTGGG - Intergenic
1004433704 6:15569467-15569489 GATTTTAAGGGGTTTGGAGTGGG - Intronic
1005887413 6:30107351-30107373 GTGTATGGGGGGCTGGGGGTTGG + Intronic
1005967202 6:30735164-30735186 GGGGTTGAGGGGGTTGGGGTTGG + Intronic
1006082443 6:31575238-31575260 GGTTTTGAGGGGCATGGGGACGG + Intergenic
1006312083 6:33268048-33268070 GTTTTTGAGCGGCCTAGTGTGGG - Intronic
1007079190 6:39086655-39086677 CTTTTTGAGGGGCTTTGTTTGGG + Exonic
1007450678 6:41939042-41939064 GTTTTTGGAGGGGTTGGGGCTGG - Intronic
1007564921 6:42842623-42842645 TTTTTCTAGGGGCTTTGGGTGGG - Intronic
1007713930 6:43842780-43842802 GTTTTTGGGGGGGCTGAGGTGGG - Intergenic
1008189205 6:48433452-48433474 TATATTGAGGGGCTTGAGGTAGG + Intergenic
1008770533 6:54973235-54973257 TTTTTTGGGGGGATGGGGGTGGG + Intergenic
1010700795 6:79044097-79044119 ATTTTTTGGGGGTTTGGGGTGGG - Intronic
1011497396 6:87950089-87950111 GCTCTTGAGGTGCTTGGGGAAGG + Intergenic
1013455891 6:110329491-110329513 TTTTTAGAGGGGGTGGGGGTGGG + Intronic
1014160367 6:118160908-118160930 TTTTTTGAGGAGGTTGGGGGTGG + Intronic
1014172015 6:118289011-118289033 GATTTTGAGGAGCTGGGGGTGGG - Intronic
1014965475 6:127742749-127742771 GGTTGTCAGGGGCTGGGGGTGGG + Intronic
1015779050 6:136844657-136844679 GTTTGCCAGGGGCTGGGGGTGGG - Intronic
1016918898 6:149271991-149272013 GTCTTTGGGGGGTTGGGGGTGGG - Intronic
1017085260 6:150707643-150707665 ATTTTTGGGGGGCTTGGGGTTGG - Intronic
1018184929 6:161258655-161258677 TTTTTTGCGGGGAGTGGGGTGGG - Intronic
1020109128 7:5438297-5438319 GTTTCTGATGTGCTTGGGGAAGG - Intronic
1020162897 7:5785761-5785783 TTTTTGGAGGGGGGTGGGGTGGG + Intergenic
1020164067 7:5794505-5794527 TTTTTTGTGGGGGTGGGGGTGGG + Intergenic
1020402750 7:7796850-7796872 GTTTTTAAGGGTTTTGGAGTGGG - Intronic
1021088472 7:16452042-16452064 ATTTTTGTTGGGCTTGGGGGTGG + Intergenic
1021434522 7:20599199-20599221 GCTTCTGAGGGACTTGGGATCGG + Intergenic
1021438942 7:20655479-20655501 TTTTTTGGGGGGCTGGGGGGAGG - Intronic
1021465866 7:20943064-20943086 GGTTTCCAGGGGCTTGGGGGAGG + Intergenic
1022010074 7:26301146-26301168 GTTTTTGGGGGGATTTGGGAAGG - Intronic
1022090130 7:27102540-27102562 CTTTTGGAGGGGCTTTGGGGGGG + Exonic
1023905277 7:44517320-44517342 GTTTTTCAGGGGCTTGTGATAGG + Exonic
1024015185 7:45307284-45307306 GTTTTCCATGGACTTGGGGTGGG + Intergenic
1024026832 7:45416991-45417013 GTTTGTCAGGGGCTGGGTGTAGG + Intergenic
1024551437 7:50565818-50565840 GATTTTGATGGGTTTGGGGAAGG - Intergenic
1025111878 7:56223916-56223938 CTTTTTGAGGGGAATGAGGTGGG + Intergenic
1026411300 7:70125848-70125870 GTTTTTTAGTTGCTTGAGGTGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026988676 7:74570838-74570860 GTTTTGGAGGGGCTGTGGGGAGG + Intronic
1027166690 7:75839604-75839626 GTTTTTTAGGGTTTTGGAGTAGG + Intergenic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027430012 7:78102183-78102205 GGTTGTCAGGGGCTGGGGGTTGG + Intronic
1028895720 7:96039689-96039711 GTTGTGGATGGGGTTGGGGTTGG - Intronic
1029296250 7:99542938-99542960 TTTTTGGCGGGGCCTGGGGTGGG - Intergenic
1029446685 7:100616970-100616992 CTTTCTGAGGGGCTGGGGGCAGG + Intergenic
1029459840 7:100688252-100688274 GTGTTTGAGAGGCCGGGGGTGGG + Exonic
1031898718 7:127386174-127386196 TTTTTTGTGGGGATTGGGGTGGG - Intronic
1032114840 7:129108174-129108196 ACTTTTGGGGGTCTTGGGGTAGG - Intergenic
1032299691 7:130675376-130675398 TTTTTTGGGGGGGGTGGGGTGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034333420 7:150304024-150304046 GTTTTAGAGGGGCATGGAGGTGG - Intronic
1034664621 7:152805865-152805887 GTTTTAGAGGGGCATGGAGGTGG + Intronic
1035205059 7:157289756-157289778 GTTTCTCAGGGGCTGGGGTTGGG + Intergenic
1035731510 8:1856732-1856754 GTGTTGGAGGGGCTTGGTTTGGG + Intronic
1036117057 8:5970273-5970295 GTGTTGGTGGGGCTGGGGGTGGG - Intergenic
1036985196 8:13521245-13521267 CTGTTGGAGGGGCTTGGGGAGGG + Intergenic
1037938507 8:22931397-22931419 GGTTGTCAGGGGCTGGGGGTAGG - Intronic
1037991393 8:23323700-23323722 TTTTTTGGGGGGGTGGGGGTGGG + Intronic
1038051912 8:23821866-23821888 CTTTGTAAGGGGCTTGGGCTGGG + Intergenic
1038561303 8:28582868-28582890 GATATGGAGGGACTTGGGGTAGG - Intergenic
1039518300 8:38151093-38151115 GTTTGTGGGGAGCTTGGGGCGGG + Exonic
1039854721 8:41402383-41402405 GTTCTTGAGGGGTGTGGGGATGG + Intergenic
1040555541 8:48474725-48474747 GTTTATCAGGGACTGGGGGTAGG + Intergenic
1041116316 8:54541018-54541040 TTTTTTGGGGGGGTTGGGGGAGG + Intergenic
1041547672 8:59064061-59064083 ATTATTGAAGTGCTTGGGGTGGG + Intronic
1041719290 8:60961701-60961723 GTTTTCCAGGGGCTGGGGCTGGG + Intergenic
1041734468 8:61095269-61095291 GTTTTTTAGGGGCAGGAGGTAGG + Intronic
1042024402 8:64407446-64407468 GTTTCTCAGTGGCTTGGAGTAGG + Intergenic
1042490654 8:69393894-69393916 GTTTTTGGGGGGATGCGGGTGGG - Intergenic
1042602659 8:70513323-70513345 GATTTGGAGGGGCCAGGGGTAGG + Intergenic
1042872239 8:73409774-73409796 GATTTTGAGGGGTTTGGAGCAGG + Intergenic
1043093678 8:75937328-75937350 TTTTTTGTGGGGGTTGGGTTGGG - Intergenic
1043566481 8:81554336-81554358 GTTTTTGAGGGGATTGAAATAGG - Intergenic
1045295219 8:100866594-100866616 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1045752990 8:105508425-105508447 TTTTTTTAGGGGCATGGGCTGGG + Intronic
1045976492 8:108135277-108135299 GGTTTCCAGGGGCTGGGGGTAGG + Intergenic
1046325762 8:112643129-112643151 GTGTTTGAGGAGCTTTTGGTTGG + Intronic
1048039632 8:130713350-130713372 GTTTTTCAGAGGCTTGGGAGAGG - Intergenic
1048547537 8:135401649-135401671 GTTATGGAGAGGCTGGGGGTAGG + Intergenic
1048883211 8:138887182-138887204 GATAGTGAGGGGCTAGGGGTGGG - Intronic
1048981344 8:139704490-139704512 GAGTTTGAGGGACTCGGGGTTGG + Intergenic
1050354178 9:4767818-4767840 GTTATTGGGGTGGTTGGGGTAGG + Intergenic
1051137226 9:13935803-13935825 TTCTTTGAGGTGCCTGGGGTAGG - Intergenic
1053020470 9:34690682-34690704 GTGTGGGAGGGGCGTGGGGTAGG + Intronic
1053089206 9:35258423-35258445 GTTTTTGTGGTGGTTGTGGTGGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055587478 9:77770380-77770402 GTTTTTTGGGGTCTTGGGATGGG - Intronic
1056243131 9:84669084-84669106 GTTTTGGAGGGGCTTCCTGTTGG - Intronic
1056920969 9:90789012-90789034 TTTATTGATGGGGTTGGGGTGGG - Intergenic
1057537493 9:95927189-95927211 TTTTTTGAGGGACTAGGGGGAGG + Intronic
1057611329 9:96546446-96546468 TTTTTTGCGGGGAGTGGGGTGGG + Intronic
1058708613 9:107658912-107658934 TTTTTTGGGGGGGTGGGGGTGGG - Intergenic
1058792411 9:108463401-108463423 GGTTTTCAGGGGCTGGAGGTAGG + Intergenic
1059213713 9:112539685-112539707 TTTTTTGCGGGGGTGGGGGTTGG + Intronic
1059255621 9:112928281-112928303 TTTTTTGAGAGGTTGGGGGTGGG + Intergenic
1059581531 9:115554788-115554810 CTTTTTGGGGGGCTGGGGGTGGG + Intergenic
1059955124 9:119507793-119507815 GGGTTTGAGGGGCTAGGGGAGGG + Intronic
1060225203 9:121786235-121786257 GTTTCTGAGGGGTTTGGGCTAGG - Intergenic
1060791437 9:126488259-126488281 CTTAGTGAGGGGCTTGGGGGTGG + Intronic
1203755553 Un_GL000218v1:122089-122111 TTTGTTGAGGGGCTTGAGGCGGG + Intergenic
1186154128 X:6708063-6708085 TTTTTTGAGGGGGTTAGGGTGGG - Intergenic
1187674954 X:21707104-21707126 GGTTGCCAGGGGCTTGGGGTGGG - Intronic
1188927480 X:36062686-36062708 TGTTTTCAGGGGCTGGGGGTGGG + Intronic
1189093695 X:38114838-38114860 GGTTATCAGGGGCTGGGGGTGGG - Intronic
1189315818 X:40055815-40055837 TTTTTTGCGGGGGTGGGGGTGGG + Intronic
1189962912 X:46341508-46341530 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1190329169 X:49225157-49225179 AGTTTTGAGGGGCTTGGAGATGG + Intronic
1190441099 X:50475059-50475081 TTTTCTGGGGGGCTGGGGGTGGG + Intergenic
1190722091 X:53157833-53157855 GTTTTCAAGGGGATGGGGGTGGG - Intergenic
1192282252 X:69699297-69699319 GTTTTTGAAGGTTTTGGGCTTGG + Intronic
1192329721 X:70165508-70165530 TTTGTTTAGGGGCTTGGGGGGGG + Intronic
1192487799 X:71545284-71545306 TTTTTTTAAGGGGTTGGGGTGGG - Intronic
1192677723 X:73216108-73216130 GGTTTTCAGAGGCTTGGGGTAGG + Intergenic
1193730496 X:85096846-85096868 TTTTTTGAGGGGGCTGGGGTGGG - Intronic
1193797974 X:85899677-85899699 GTTTTTTTGGGGCGGGGGGTGGG - Intronic
1194002359 X:88446265-88446287 GGTTACCAGGGGCTTGGGGTGGG + Intergenic
1194207698 X:91031723-91031745 GTTTCCCAGGTGCTTGGGGTGGG + Intergenic
1194891690 X:99386378-99386400 GGTTTTCAGGGGCTGGGGGAAGG - Intergenic
1195060306 X:101187805-101187827 TTTGTTGAGGGGCTCGAGGTGGG + Intergenic
1195412221 X:104579953-104579975 GTTTGTGTGGGGATAGGGGTGGG - Intronic
1195671380 X:107473020-107473042 GTTTTTGATTGGCTTGGGTAAGG - Intergenic
1196054437 X:111339977-111339999 GTATTTGTGGGGCATGGGGAGGG - Intronic
1196230860 X:113219409-113219431 GTTTTTGACTGTATTGGGGTTGG + Intergenic
1196838940 X:119839966-119839988 GATGATGAGGGGCTTGGGGGAGG - Intronic
1197742814 X:129908610-129908632 ATTTTATGGGGGCTTGGGGTTGG - Intronic
1197859182 X:130951013-130951035 CTTTTTGAGGGGGTGGGGGAAGG + Intergenic
1198117332 X:133556764-133556786 GTTTTTGGGGGGGTGGGGGGAGG + Intronic
1200021526 X:153214759-153214781 GCTTCTGAGGGGATTGGGCTGGG - Intergenic
1200356836 X:155561486-155561508 ATTTGTGAGGGGCCAGGGGTGGG - Intronic
1200988796 Y:9328924-9328946 TTTTTTGGGGGGTGTGGGGTGGG - Intergenic