ID: 1178300887

View in Genome Browser
Species Human (GRCh38)
Location 21:31451929-31451951
Sequence CAGCCACCAGATTTTTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178300887_1178300893 23 Left 1178300887 21:31451929-31451951 CCAGACTAAAAATCTGGTGGCTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1178300893 21:31451975-31451997 GAGATGAAGAAGTTGGAAGAGGG 0: 1
1: 0
2: 3
3: 69
4: 696
1178300887_1178300891 16 Left 1178300887 21:31451929-31451951 CCAGACTAAAAATCTGGTGGCTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1178300891 21:31451968-31451990 GCTAATAGAGATGAAGAAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 298
1178300887_1178300892 22 Left 1178300887 21:31451929-31451951 CCAGACTAAAAATCTGGTGGCTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1178300892 21:31451974-31451996 AGAGATGAAGAAGTTGGAAGAGG 0: 1
1: 0
2: 7
3: 106
4: 869

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178300887 Original CRISPR CAGCCACCAGATTTTTAGTC TGG (reversed) Intronic
902807683 1:18871367-18871389 CAGCCAACATCTTTTAAGTCTGG - Intronic
905609138 1:39333778-39333800 CAGCCACCAGAATTTTAGAGAGG + Intronic
908618826 1:65952712-65952734 AACCCACCAGTTTTATAGTCAGG + Intronic
910090745 1:83460776-83460798 CAAACACCAGATTTTTGTTCTGG + Intergenic
913106501 1:115618386-115618408 CAGCTACCAGAGTATGAGTCTGG - Intergenic
917878141 1:179305768-179305790 CAGCCAACAGATTAATAATCTGG + Intronic
924316434 1:242802321-242802343 CAACAAGCAGATTTTTAGCCAGG - Intergenic
1068378836 10:56220809-56220831 GAGACACCAGATTTTTTGTCTGG - Intergenic
1068639491 10:59387322-59387344 CAGACACTAGATTTCAAGTCAGG - Intergenic
1073170402 10:101502124-101502146 CAACAGCCAGAATTTTAGTCTGG + Intronic
1074470614 10:113723297-113723319 CAGACTCCTGATTTCTAGTCTGG - Intronic
1080208773 11:29760997-29761019 GAGCCACGAAATTTTAAGTCTGG - Intergenic
1081778653 11:45694684-45694706 CAGCCAGCAGAGGTTTAGTTAGG - Intergenic
1091444417 12:535387-535409 CAGCCCCCAGAGTCCTAGTCTGG + Intronic
1095339792 12:41075807-41075829 CAGCCACCTGATATTTCTTCTGG - Intergenic
1103049976 12:117770611-117770633 CAGCCACCAGATTCTGTGTTAGG + Intronic
1103635892 12:122304830-122304852 CAGCCATCATAATTTTAATCTGG - Intronic
1107250072 13:38349616-38349638 TTGCTACCATATTTTTAGTCAGG - Intergenic
1113976869 13:114234654-114234676 CAGCCACCTGCTTTTTTGCCCGG + Intergenic
1114237094 14:20833159-20833181 CAGCCCCCACCTTTTTAGACTGG - Intergenic
1117120942 14:52567977-52567999 CAGCCACCAGGTAGTTAATCTGG - Intronic
1120174264 14:81276894-81276916 CACCCACCTGAGTTTTTGTCCGG + Exonic
1121909565 14:97776710-97776732 CTGCAATGAGATTTTTAGTCAGG - Intergenic
1124654036 15:31494387-31494409 GAGCCAGCAGATTTGGAGTCTGG - Intronic
1126538135 15:49790934-49790956 CATCAACCAGATTATTAGTGGGG - Intergenic
1127750432 15:62035413-62035435 CAGTGACCAGATTATTAGTAAGG + Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1136861203 16:33704815-33704837 CAGCCAACAGTTTTTTTGTTTGG - Intergenic
1137772207 16:51025405-51025427 TAGCCACCAGGCCTTTAGTCAGG - Intergenic
1138123108 16:54416255-54416277 CAGACACCATAATTTCAGTCTGG + Intergenic
1142428815 16:90015113-90015135 AAGCCACCAGGTGTCTAGTCTGG + Intronic
1203122700 16_KI270728v1_random:1553006-1553028 CAGCCAACAGTTTTTTTGTTTGG - Intergenic
1148172843 17:45537732-45537754 CGGCCACCAGATTTTTATGAGGG + Intergenic
1148276424 17:46307718-46307740 CGGCCACCAGATTTTTATGAGGG - Intronic
1148298540 17:46525293-46525315 CGGCCACCAGATTTTTATGAGGG - Intronic
1148363076 17:47029769-47029791 CGGCCACCAGATTTTTATGAGGG - Intronic
1148769946 17:50060850-50060872 CAGCCACCTGCTTTTAGGTCTGG - Intronic
1150404050 17:64884655-64884677 CGGCCACCAGATTTTTATGAGGG + Intronic
1150443439 17:65210266-65210288 CTGCCATCAGATTTTAGGTCAGG - Intronic
1152827562 17:82477028-82477050 CAGCCAACAGTTTTTTAAGCAGG + Intronic
1153557596 18:6332396-6332418 CAGCTACCTGATTTTTAGTTTGG + Intronic
1161247929 19:3264808-3264830 CAGGCACAAGATTTTGAATCAGG - Intronic
924977100 2:187933-187955 CAGACACAGGTTTTTTAGTCTGG + Intergenic
925767455 2:7250412-7250434 CAACCACAAGATTTCTAGTTTGG - Intergenic
934459576 2:94205941-94205963 CAGCCAACAGTTTTTTTGTTTGG - Intergenic
939788274 2:146542637-146542659 CAGCCAGTAGACTTTTAATCAGG + Intergenic
948446074 2:238034000-238034022 CAGCCACCATAATTTTTTTCTGG + Intronic
948825647 2:240572412-240572434 CAGCCACCAGATCTGTGGGCAGG - Exonic
1169913557 20:10666668-10666690 TAGCAAACAGATCTTTAGTCTGG + Intronic
1172067638 20:32233063-32233085 CACTCACCAGATTTTTACTGGGG + Intronic
1172925862 20:38534504-38534526 AAGCCACCATATTTTTATTTGGG - Intronic
1177650790 21:23959598-23959620 ATGCCACCAAATTTTTATTCAGG - Intergenic
1178125630 21:29512780-29512802 CTGCCACCATATTTGTAGTCTGG + Intronic
1178300887 21:31451929-31451951 CAGCCACCAGATTTTTAGTCTGG - Intronic
1179168520 21:38954533-38954555 CAGCCACCAGTTTTTTGCTGTGG + Intergenic
950185439 3:10942458-10942480 CAGCCACCATATTCTTTGTGTGG + Intergenic
950632234 3:14290150-14290172 CAGACACAGGATTTTTAGTCAGG - Intergenic
952156946 3:30653743-30653765 GAGCCACAAGATTTTAAGTATGG + Intronic
961156450 3:124683747-124683769 CAGCCACCAGATATTTAGCTTGG + Intronic
975308337 4:72874653-72874675 CTTCCACCCTATTTTTAGTCAGG - Intergenic
976704172 4:88004674-88004696 CTGCCAGCAGATTTGTGGTCTGG - Intergenic
984302158 4:177935182-177935204 CAGCAACCAGATTTTTCCTTGGG - Intronic
991596417 5:68311329-68311351 CAGCCATCACATTTGTATTCAGG + Intergenic
996845164 5:127890827-127890849 CTTCCACCAGATGTTTTGTCGGG - Intergenic
999100195 5:149017463-149017485 CAGCCTTCAGGTTTTTACTCTGG - Intronic
1002966322 6:1970092-1970114 CCGACACCACATTTGTAGTCAGG - Intronic
1003302988 6:4901885-4901907 CAGCCTCCACTTTTTCAGTCAGG + Intronic
1006612261 6:35301222-35301244 CAGCCAGCAGGTTTTTGGACTGG - Intronic
1006841783 6:37032999-37033021 CAGTCCCCAGATTTTTATTGAGG - Intergenic
1011686191 6:89825645-89825667 GAGCCAGCAGATTTATTGTCTGG - Intergenic
1016294774 6:142562964-142562986 CAGCCCCCAGAGGTGTAGTCAGG + Intergenic
1018646576 6:165954344-165954366 CAGCCACCACGTTTATATTCAGG - Intronic
1027307589 7:76917239-76917261 CAAACACCAGATTTTTGTTCTGG + Intergenic
1027719341 7:81719501-81719523 CAGACACCAGATTTTGAATATGG + Intronic
1028516629 7:91684570-91684592 AAGCCACCAAATTTTGAGCCTGG + Intergenic
1036424069 8:8627139-8627161 CAGACACCAGCTCTTTAGTATGG + Intergenic
1036546965 8:9780875-9780897 CAGCTACCAGATTTCTGGTTTGG + Exonic
1037431010 8:18813192-18813214 CTTCCACCAGCTTTTAAGTCAGG - Intronic
1043365165 8:79524449-79524471 AAGGCACCAGATTTATATTCAGG - Intergenic
1044734266 8:95262350-95262372 TAGTCACTTGATTTTTAGTCTGG + Intronic
1044839450 8:96325494-96325516 CAGCCTCCAGGTTTTTAGCTGGG - Intronic
1057930688 9:99190456-99190478 AAGCCTCCAGATCTTTAGCCTGG + Intergenic
1060840662 9:126790852-126790874 CAGCCACCTGATTGTTTGCCTGG + Intergenic
1186948373 X:14594849-14594871 CAGCCACTGGGATTTTAGTCAGG + Intronic
1187685508 X:21811929-21811951 AAGCCACTAGATTTTTAGAATGG - Intergenic
1188879129 X:35470544-35470566 AATCCACCAAATTTTTAGTCTGG - Intergenic
1191214650 X:57922035-57922057 AAGCCACCAGAATTTGAATCTGG + Intergenic
1201219947 Y:11758876-11758898 CAACAAGCAGATTTTTAGCCAGG - Intergenic
1201305025 Y:12542584-12542606 CAGCATCCAGATCTTTTGTCTGG - Intergenic