ID: 1178301710

View in Genome Browser
Species Human (GRCh38)
Location 21:31458784-31458806
Sequence CTACTTCAGCTTAGGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178301698_1178301710 23 Left 1178301698 21:31458738-31458760 CCGGAACAGGAAGGGGAGGGGAG 0: 1
1: 1
2: 4
3: 84
4: 495
Right 1178301710 21:31458784-31458806 CTACTTCAGCTTAGGTTCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178301710 Original CRISPR CTACTTCAGCTTAGGTTCTC AGG Intronic
907349179 1:53811746-53811768 CTACTACAGCTGAGGTTTTCCGG + Intronic
909041919 1:70663891-70663913 CTGCTTCAGCTTGGGATCTCTGG + Intergenic
909045766 1:70707126-70707148 CTACTCTAGCTCTGGTTCTCAGG - Intergenic
913352211 1:117874432-117874454 CTACTTCAGGTGAGGGACTCAGG - Intronic
917319020 1:173759373-173759395 CTACTACAGCTGATGTTTTCTGG + Intronic
918001111 1:180497295-180497317 CAACTTCTGCCTAGGTTCTGGGG + Intronic
918727973 1:187949846-187949868 CTATTTCAGATTATGTTGTCAGG + Intergenic
918748640 1:188241379-188241401 CTACTTCTGGTGAGGGTCTCAGG - Intergenic
919978400 1:202627589-202627611 CCAGTGCAGCTCAGGTTCTCTGG + Intronic
920208097 1:204307740-204307762 CTAGCTCAGCTTAGGGTTTCAGG - Intronic
922873070 1:228918660-228918682 CTACTTCTCCTAAGGTTCCCTGG - Intergenic
923038857 1:230305394-230305416 CTGCTTCTGCTGAGGGTCTCAGG + Intergenic
924258259 1:242203684-242203706 CTGCTTCTGGTGAGGTTCTCAGG - Intronic
1063078136 10:2736802-2736824 CTACTTCAGATTAGGTTTGTGGG - Intergenic
1063846139 10:10128572-10128594 CTAATTCAGTTTAACTTCTCAGG + Intergenic
1065163947 10:22954957-22954979 TTACATCAGCTTTGGTTCTCTGG - Intronic
1072255554 10:93617068-93617090 CTACTTCTGCTTTGGATCTCAGG + Intronic
1072303054 10:94080339-94080361 TAACTTCAGTTTATGTTCTCAGG + Intronic
1073746709 10:106477413-106477435 GTACTTCAGCATAATTTCTCAGG - Intergenic
1076468543 10:130702667-130702689 CTCCTGCAGCTTACTTTCTCTGG + Intergenic
1077663584 11:4089873-4089895 CTGCTTTTGCTGAGGTTCTCAGG + Intronic
1078866464 11:15302496-15302518 CTACTTCTGCTTTGCTTCTGGGG + Intergenic
1079273679 11:19013392-19013414 CTACCACAGCTGATGTTCTCTGG - Intergenic
1080980973 11:37405239-37405261 CTTTCTCAGCTTAGGTTCTTTGG - Intergenic
1085747856 11:79129876-79129898 CTACCACAGCTGAGGCTCTCTGG + Intronic
1088206451 11:107397659-107397681 CTACTACAGCTGATGCTCTCTGG + Intronic
1090580722 11:128155560-128155582 TTACTACTGCTTAAGTTCTCAGG + Intergenic
1090821400 11:130345537-130345559 CTGCTTCAGCATTGCTTCTCTGG + Intergenic
1091812323 12:3409759-3409781 CCACTTCAGCTCAGGTGCTGGGG + Intronic
1093275116 12:17116456-17116478 CTGCTTCAGCTCAGGCTCTGTGG - Intergenic
1093474166 12:19536288-19536310 CTACTACAGTCTAGGTTTTCAGG - Intronic
1094481444 12:30885521-30885543 TTACTTCAGCTCAGGTGCTGGGG - Intergenic
1095442593 12:42253128-42253150 CTCCTTCAGCTTAGTTTGGCTGG + Intronic
1098377972 12:69837611-69837633 CTACTTTTGCTTAACTTCTCTGG - Intronic
1098560419 12:71865909-71865931 CCACTTCAGCTTGGGTACTGGGG + Intronic
1099477129 12:83121654-83121676 CTACCACAGCTTATGCTCTCTGG - Intronic
1100858893 12:98783941-98783963 CTACTTCAACTCAGGTGCTTAGG - Intronic
1101798538 12:108000631-108000653 CTGCTTCAGCTTAGGTACTGGGG + Intergenic
1105064553 12:133185218-133185240 CTACTTTAGCTTGGGTGCTCAGG + Intronic
1105573925 13:21631950-21631972 CAACTTCAACTTAGGTCCCCAGG - Intergenic
1107012047 13:35679079-35679101 CTACTACAGCTCTGTTTCTCTGG - Intergenic
1108509670 13:51145216-51145238 CTTCTGAAGCTTAAGTTCTCTGG - Intergenic
1108716299 13:53081402-53081424 CTGCTTCAGCTCTGGCTCTCTGG + Intergenic
1110544700 13:76743579-76743601 AAACTTCAGCTTGGGTTCTTGGG - Intergenic
1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG + Intergenic
1117639869 14:57786408-57786430 CTACTACAGCTGATGCTCTCTGG + Intronic
1118496922 14:66316181-66316203 CTGCTTCAACTTAGGTACTAGGG - Intergenic
1118917078 14:70116548-70116570 CCACTTCATCATTGGTTCTCAGG + Intronic
1124494026 15:30175528-30175550 CCAGTGCAGCTCAGGTTCTCTGG + Intergenic
1124749544 15:32363118-32363140 CCAGTGCAGCTCAGGTTCTCTGG - Intergenic
1125269370 15:37921467-37921489 CTACTACAGCTGATGCTCTCTGG - Intergenic
1127234997 15:57039500-57039522 CTACTTCAGCAAATGTTTTCTGG + Intronic
1128678638 15:69630015-69630037 CCTCGTCAGCTTAGGTGCTCTGG + Intergenic
1128807145 15:70539536-70539558 CTGTTGCAGGTTAGGTTCTCAGG - Intergenic
1133319555 16:4904498-4904520 CTACTTCAGCTCTGGTGGTCAGG + Intronic
1135473456 16:22752615-22752637 CTGCTTCACCTTAGGGACTCAGG + Intergenic
1138001222 16:53281850-53281872 CTACTTAAGCTGAGGTTGGCAGG - Intronic
1138093801 16:54196571-54196593 CTACTTCTGGTGAGGGTCTCCGG + Intergenic
1142305409 16:89281676-89281698 CTCCTTGAGCTTGGGGTCTCCGG + Exonic
1147489550 17:40852424-40852446 CTACTTCAGCTTTGTGTCTTTGG + Intergenic
1152065988 17:78112809-78112831 CCACTCCAGCTGAGGTTCCCAGG + Exonic
1157218634 18:45807369-45807391 CTACTGCAGCTGATGCTCTCTGG + Intergenic
1157607163 18:48933177-48933199 CTACTTCTGCTTTGGTTGTGTGG - Intronic
1159787121 18:72727349-72727371 CTACTACAGCTGATGCTCTCTGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1165483825 19:36083278-36083300 CAGCTCCAGCTCAGGTTCTCAGG + Intronic
1166024543 19:40069217-40069239 CTGCTTCTGCTAAGGGTCTCAGG + Intronic
927176290 2:20411207-20411229 TCACTTCAGCTTAGGTACTGGGG + Intergenic
927560816 2:24071665-24071687 CTACTTCAGCTAGGGTGGTCAGG + Intronic
927782966 2:25954263-25954285 CTACTTGAGCTTGAGTTCGCGGG + Exonic
930312795 2:49763101-49763123 CTACTTCTACTTATTTTCTCTGG - Intergenic
931854467 2:66287516-66287538 CTACTTCTGGTGAGGGTCTCAGG + Intergenic
932059973 2:68486566-68486588 CTGCTCCAGCATAGGTTCTGGGG + Intronic
937494590 2:122403984-122404006 CAGCTTCAGCTCAAGTTCTCAGG + Intergenic
937842320 2:126536056-126536078 CTACTGCACCTTTAGTTCTCAGG - Intergenic
938561053 2:132472218-132472240 CTACTCCAGATAAAGTTCTCAGG - Intronic
940186068 2:150985971-150985993 GTACTTCAGCTTAGGTCCCTAGG - Intergenic
940186131 2:150986329-150986351 CTACTTCAGCTTTAGTACTATGG - Intergenic
940558865 2:155267766-155267788 TTACTTCAACTTTGGTTGTCTGG - Intergenic
940983088 2:160024600-160024622 CTGCTTCAGCTTAGGTGCTGGGG - Intronic
945103816 2:206289279-206289301 CCACTTCAGCTTAGGTATTGGGG + Intronic
945476228 2:210285401-210285423 CCACTTCAGCTTAGGTACTAGGG + Intergenic
1169441560 20:5638020-5638042 CTCCTCCAGCTCAGCTTCTCAGG - Intergenic
1172025253 20:31943975-31943997 CTGCTTCAGAGTAGTTTCTCTGG + Exonic
1173464252 20:43268545-43268567 CTACATCAACTTAGGATATCAGG + Intergenic
1178301710 21:31458784-31458806 CTACTTCAGCTTAGGTTCTCAGG + Intronic
1181611282 22:24014380-24014402 CTCCTTCAGGTTAGCTTCTGTGG + Intronic
951034767 3:17921017-17921039 CTACTTTAGGTGAGGTGCTCAGG + Intronic
951778903 3:26340877-26340899 CCACTTCAGCTTAGGTACTGTGG + Intergenic
951978770 3:28543196-28543218 CTACTTCAGTTAAATTTCTCGGG + Intergenic
952955088 3:38551856-38551878 CTTCTACATCTTGGGTTCTCAGG + Intronic
958770713 3:98422114-98422136 CTACTACAGCTGATGGTCTCTGG + Intergenic
961136463 3:124516122-124516144 CCACTTCAGGTTAGGTCCTCAGG + Intronic
962388241 3:134950532-134950554 CTACTTCTGCTGAGGGCCTCAGG + Intronic
962496493 3:135945349-135945371 CTGCTTCAGCTTAGGTAGTGGGG + Intergenic
962695615 3:137944548-137944570 CCATTCCAGCTTGGGTTCTCTGG + Intergenic
967335228 3:188336967-188336989 CTACTTCAGATTAAGTACTGGGG + Intronic
967413823 3:189195188-189195210 CTGCTTCAGCTTAGGTACTGGGG + Intronic
967549395 3:190772866-190772888 CTCCCTCAGTTTTGGTTCTCTGG + Intergenic
970784177 4:19776063-19776085 CCACTTCAGCTCAGGTGCTGGGG - Intergenic
971054255 4:22895106-22895128 TTACTTCAGATTAGGTAATCAGG + Intergenic
971888597 4:32486106-32486128 AAAGTTCTGCTTAGGTTCTCAGG + Intergenic
971963937 4:33527062-33527084 CTACTTCAGATTAACTTCCCTGG + Intergenic
972745644 4:41929990-41930012 CTACTTCAGCTTGGGGTCTAAGG + Intergenic
973069122 4:45835488-45835510 CTACTACAGCTGATGATCTCTGG - Intergenic
975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG + Intergenic
977870350 4:102083166-102083188 CTACTTCAGTTTAGGTGACCAGG + Intergenic
978319144 4:107475136-107475158 CTTCTTCAGCTTGTGTTCTAGGG + Intergenic
979267753 4:118723354-118723376 GAACTTCAGCTTTGGTGCTCAGG - Exonic
983649192 4:170021661-170021683 ATCCTTCAGTTTAGGTTTTCTGG + Intronic
984041526 4:174740350-174740372 CTCCTTCAGTGTAGTTTCTCTGG - Intronic
984266670 4:177505245-177505267 CTACTACAGCTGATGTTTTCCGG - Intergenic
985355792 4:189117196-189117218 CTACTTCAGCTGATGCTGTCTGG + Intergenic
987152450 5:15056529-15056551 CCACTTCAGCTTAGGTAGTAGGG + Intergenic
988310998 5:29556835-29556857 CCACTTTACCTTAGGTTCTGGGG + Intergenic
988813605 5:34808833-34808855 CTACTGCAGCTCAGGTCATCAGG + Intronic
988902263 5:35745812-35745834 CTACTACAGCTGATGCTCTCTGG + Intronic
989522507 5:42418400-42418422 CTGCTTCAGCTTATTCTCTCTGG + Intergenic
991098992 5:62770929-62770951 CTACTTCTGGTGAGGGTCTCAGG - Intergenic
991961357 5:72047750-72047772 CTCCTTCCTCTTAGGTTCTGTGG - Intergenic
993250301 5:85513104-85513126 CTACTTCAGCTGATGCTCTCTGG - Intergenic
993671563 5:90766797-90766819 ATACTCCAGCCAAGGTTCTCAGG - Intronic
993917083 5:93756366-93756388 CTACTACAGCTGATGTTCTCTGG + Intronic
994128760 5:96199881-96199903 CTATTCCAGCTTTAGTTCTCCGG + Intergenic
994222147 5:97208514-97208536 CTACCACAGCTGAGGCTCTCTGG - Intergenic
994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG + Intergenic
995817842 5:116191782-116191804 CTACTACAGCTGATGCTCTCTGG + Intronic
999506769 5:152206697-152206719 CTACTTTAGCTAAGGTGGTCAGG + Intergenic
1000965462 5:167650395-167650417 CTAATTCAGCTAAGGTTCTTAGG + Intronic
1001687984 5:173609837-173609859 CTACTTCTGCTTAGGCTATTAGG - Intronic
1004214498 6:13689042-13689064 CTGCTTCAGCTTAGCCTCCCAGG - Intronic
1004240526 6:13917216-13917238 CTATTTCAGGTTGGGTTGTCAGG + Intergenic
1005045218 6:21635463-21635485 CTACTTCACCTTCAGTTCACTGG - Intergenic
1005191394 6:23228323-23228345 CTACTACAGCTGAGGGTCTCTGG - Intergenic
1009041198 6:58180491-58180513 CTACTTCAGCTCAGATGCTTAGG - Intergenic
1009217057 6:60934809-60934831 CTACTTCAGCTCAGATGCTTAGG - Intergenic
1010545493 6:77150329-77150351 CCACTTCAGCTTTGGTTCCCAGG - Intergenic
1012295068 6:97512280-97512302 CTGCTTCTGGTTAGGGTCTCAGG + Intergenic
1014603934 6:123448702-123448724 CTACTGCAGCTGATGCTCTCTGG + Intronic
1015152344 6:130054032-130054054 CTACTTTAGGTTGGGTTGTCAGG + Intronic
1015663275 6:135600242-135600264 CTACTACAGCTGATGCTCTCTGG - Intergenic
1017727684 6:157287007-157287029 AAACTTCAACTTAGGTTCTCTGG + Intergenic
1019776908 7:2917276-2917298 CTCCTTCAGGTAAGGCTCTCCGG - Exonic
1024503103 7:50134596-50134618 CATCTTCAGCATAGGTTATCTGG - Intronic
1024545523 7:50513964-50513986 CTACTACAGCTGATGCTCTCTGG + Intronic
1024669254 7:51577321-51577343 CTACTACAGCTGATGCTCTCTGG - Intergenic
1024807008 7:53153686-53153708 CTACTTTGGCTTATGCTCTCTGG - Intergenic
1027580737 7:79991784-79991806 CTACCTCAGTTTAGGATTTCTGG - Intergenic
1031681783 7:124683738-124683760 CCATTCCTGCTTAGGTTCTCAGG - Intergenic
1032186931 7:129734789-129734811 CTACTTCCCCTTAGTTTCCCTGG - Intronic
1032773947 7:135090597-135090619 CGACTCCAGCTTAGGTACTGGGG + Intronic
1035368981 7:158366783-158366805 CGACTGCAGCTTTGGATCTCTGG - Intronic
1038049286 8:23793894-23793916 GTATTTGAACTTAGGTTCTCTGG + Intergenic
1039287964 8:36063034-36063056 CTCCTTCATCTTTGATTCTCTGG + Intergenic
1039583033 8:38682420-38682442 TTACTTCAGCTGTGGTTCTGAGG - Intergenic
1041227803 8:55717334-55717356 CTACTGCAGCTGATGTTCTCTGG + Intronic
1041706100 8:60847853-60847875 CTACTACAGCTTAGGTTCCCAGG + Intronic
1042068534 8:64904994-64905016 CCACCTCAGCTTATTTTCTCAGG - Intergenic
1042637509 8:70894622-70894644 CCACTTCAGCTTAGGTGCTAGGG + Intergenic
1045757323 8:105559649-105559671 ATACTTCAGTTTTGGTTTTCAGG + Intronic
1048647303 8:136436416-136436438 CTACTTAAGATTAGATTATCTGG + Intergenic
1048852465 8:138658069-138658091 CTGTGTCAGATTAGGTTCTCTGG - Intronic
1050505395 9:6342793-6342815 CCACTTCAGGTTAGGTACTGGGG - Intergenic
1051040836 9:12808977-12808999 CTACTTCTGGTTAGGTCCTCAGG + Intronic
1051362716 9:16295056-16295078 CTACTACAGCTGATGCTCTCTGG + Intergenic
1054782159 9:69175182-69175204 CTATTTCAGCTTCAGTTCTTAGG + Intronic
1054858360 9:69925018-69925040 CTACTTCTGGTTAGGGCCTCAGG - Intergenic
1055157406 9:73080853-73080875 CTCCTTCAGCTTTAGTTTTCAGG - Intergenic
1055346948 9:75349869-75349891 CTACTACAGTTGAGGCTCTCTGG - Intergenic
1057568328 9:96184476-96184498 CTCCTTCAGCTAAGGTTTGCAGG + Intergenic
1059609569 9:115878154-115878176 CTACTACAGCTGATGCTCTCTGG - Intergenic
1059883870 9:118722661-118722683 CTACTTTATCTTAGGTTCAGGGG + Intergenic
1060594647 9:124840808-124840830 CCACCTCTGCTTAGGTTCTCTGG - Intergenic
1185714802 X:2332746-2332768 CAACTCCTGCTTTGGTTCTCTGG - Intronic
1186891994 X:13968100-13968122 CTACTTCAGCTTGTGTTATATGG - Intergenic
1186898706 X:14030910-14030932 CTACTACAATTCAGGTTCTCAGG - Intergenic
1188045863 X:25425944-25425966 CTACCACAGCTTATGCTCTCTGG - Intergenic
1189570572 X:42291620-42291642 CTACTTCAAATAAGGGTCTCAGG + Intergenic
1191151785 X:57227648-57227670 CTACTACAGCTGATGTTTTCTGG - Intergenic
1194803261 X:98297311-98297333 CTACTTAAGGTGAGGTCCTCAGG - Intergenic
1195301000 X:103529852-103529874 CTGCTTCTGATGAGGTTCTCAGG - Intergenic
1195657142 X:107342828-107342850 CGACTTCAGATTAGGTAGTCAGG - Intergenic
1196185806 X:112743738-112743760 CTATTTCAGCCCAGGCTCTCAGG + Intergenic
1196590455 X:117481342-117481364 CTACTACAGCTGATGCTCTCTGG - Intergenic
1198303901 X:135360710-135360732 CTTCTTCAGAATGGGTTCTCTGG - Exonic
1199520625 X:148731255-148731277 CCACTTCAGTTTAGGTCCTTTGG - Intronic
1200692248 Y:6318145-6318167 CTACTTCAGATTGGGTACACAGG + Intergenic
1200713463 Y:6510798-6510820 CTACTTCAGATTGGGTACACAGG - Intergenic
1201020466 Y:9651243-9651265 CTACTTCAGATTGGGTACACAGG + Intergenic
1201043024 Y:9856582-9856604 CTACTTCAGATTGGGTACACAGG - Intergenic
1202162795 Y:21953007-21953029 CTACTTCAGATTGGGTGCACGGG + Intergenic
1202228561 Y:22633361-22633383 CTACTTCAGATTGGGTGCACGGG - Intergenic
1202314596 Y:23562806-23562828 CTACTTCAGATTGGGTGCACGGG + Intergenic
1202376422 Y:24241866-24241888 CTATTTCAGCTTGGGTTTTGGGG + Intergenic
1202494358 Y:25428253-25428275 CTATTTCAGCTTGGGTTTTGGGG - Intergenic
1202556206 Y:26107789-26107811 CTACTTCAGATTGGGTGCACGGG - Intergenic