ID: 1178303344

View in Genome Browser
Species Human (GRCh38)
Location 21:31470764-31470786
Sequence CTGTTTCTACATGGTTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303344_1178303358 30 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303358 21:31470817-31470839 CCGGCAGGTGGTGGGTACCCAGG No data
1178303344_1178303352 11 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303352 21:31470798-31470820 CCAGGAGAAGAGAGAGGAACCGG No data
1178303344_1178303348 5 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303348 21:31470792-31470814 GTCTCCCCAGGAGAAGAGAGAGG No data
1178303344_1178303354 18 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303354 21:31470805-31470827 AAGAGAGAGGAACCGGCAGGTGG No data
1178303344_1178303356 22 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data
1178303344_1178303353 15 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303353 21:31470802-31470824 GAGAAGAGAGAGGAACCGGCAGG No data
1178303344_1178303355 21 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303355 21:31470808-31470830 AGAGAGGAACCGGCAGGTGGTGG No data
1178303344_1178303346 -7 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303346 21:31470780-31470802 GAAACAGCCACTGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303344 Original CRISPR CTGTTTCTACATGGTTTTCC CGG (reversed) Intronic